1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
8

When a hot surface is touched, receptors in the hand send a signal to the nervous system. The nervous system then sends a signal

to the muscles in the arm to contract and move the hand from the hot surface. Which of these best describes this example?
Biology
1 answer:
bearhunter [10]3 years ago
5 0

a behavioral response requires coordination and communication between different parts of the body.

You might be interested in
A population of Drosophila simulans carries three alleles at the white locus: the wild-type allele at 86 percent, w1 at 9 percen
vladimir1956 [14]

Answer:

the population is polymorphic.

Explanation:

Polymorphism is the discontinuous genetic variation that leads to the production of varying unique kinds or forms of individuals within the population of an individual species.

Take for instance, allelic polymorphism is seen in the presence of multiple alleles that is produced within the members of an individual species as in peppered moths, human blood groups, and two-spotted ladybugs.

We have different causes of polymorphism: polymorphism can be sustained by an equity among variation developed by new mutations and natural selection. Genetic variation might be due to frequency-dependent selection.

3 0
3 years ago
The hereditary material in corn plants can be altered by scientist so the plants produce more corn. which term identifies this p
Slav-nsk [51]

Answer:

Genetic engineering

Explanation:

So there's Environmental degradation ,Ecological succession

Genetic engineering , Selective breeding . and so all the other ones aren't related to the materiel in corn so that makes it Genetic engineering ing

6 0
2 years ago
How are Skylab and Salyut similar?
umka2103 [35]

Answer:

they are both space stations

Explanation:

trust me it's correct (: !

7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
_____determine how cells are differentiated.
Jlenok [28]
Might be Cell Differentiation...
8 0
3 years ago
Read 2 more answers
Other questions:
  • What impact has the baby boomer generation had on manufacturing industries in the secondary sector of the economy?
    11·1 answer
  • In the lock-and-key model of enzyme action, the ___________ fits into the __________ of the enzyme.
    8·2 answers
  • Giving BRAINLIST if you help fast!!
    6·2 answers
  • Which events take place during mitosis but not during binary fission? Select all correct answers
    11·1 answer
  • When genes are transferred from one individual to another other than through mating, it is referred to as
    14·1 answer
  • How does the movement of particles of matter change when temperature increases?
    12·1 answer
  • The leaves on a green plant soak up sunlight to make food. A cow's stomach digests grass that was eaten. These are examples of w
    13·2 answers
  • In which way are euglena and a volvox diferent​
    12·1 answer
  • If the pH of pure water is 7, ammonia is 12, and coffee is 5, which is acidic, which is
    11·1 answer
  • Why is diet an issue give scientific reasons​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!