1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
6

How does human evolution or natural selection relate to the susceptibility of disease?

Biology
1 answer:
Papessa [141]3 years ago
7 0
Human evolution is similar to every evolution in the animal and plant kingdom. Forced by the environment both internal and external forces, animals adapted to the extreme conditions they were put in. As humans evovled, bacteria and other microorganisms also evolved to better attack and obtain food from other organisms including mankind. 
You might be interested in
A megakaryocyte will eventually produce _______.
Damm [24]

the answer is thrombocytes

7 0
3 years ago
Read 2 more answers
During an experiment, readings for blood presure in a persons body were found to be constant. However when measured by a differe
kow [346]

Answer:

The difference in the given case indicates that the results are reliable but not accurate. Precision is the tendency of an apparatus to provide repeatable quantities, that is, inaccuracies are minor. The application of standard deviation is generally used as a precision error.  

Accuracy refers to the part of an apparatus that provides measures whose average is nearer to the accurate value. It is the reproducibility of an apparatus.  

6 0
3 years ago
Research shows that the average height of all Earth's oceans is increasing over time. Which of the following is a possible cause
Aneli [31]

Answer:

polar ice caps are melting

8 0
2 years ago
Why did Mendel use pea plants in his experiments?
Digiron [165]

Answer:

C.) They self-fertilize

Explanation:

Mendel used pea plants because they self fertilized, meaning that the plant could supply a sperm and egg cell so it could produce its own offspring. This makes the process of looking at genetics and traits much easier for the scientist studying the genes of plants.

8 0
2 years ago
Which chamber of the heart pumps deoxygenated blood to the lungs?
Kamila [148]
The right ventricle pumps deoxygenated blood to the lungs.
5 0
3 years ago
Read 2 more answers
Other questions:
  • The figure shows eyes found among living molluscs, ranging from a patch of pigmented cells in a limpet to a complex, image-formi
    6·2 answers
  • Define brain death, agonal phase, clinical death and mortality.
    8·1 answer
  • Snakes eat bats. Hawks also eat bats. Bats eat moths and so do spiders. Moths eat nectar from plants. When completely diagramed,
    5·1 answer
  • Help with number 16 pweez if U know the answer to the other questions pweez answer them, thx if u do! ❤
    10·1 answer
  • What are the basic needs od all cells in the body
    9·1 answer
  • If water evaporates from the ocean and becomes water vapor what has happened to its energy level?
    7·1 answer
  • Is a cell of an oak leaf prokaryotic or eukaryotic?
    9·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Explain why Archimedes is considered one of the fathers of the scientific method?
    13·1 answer
  • What are the following a basin, channel, confluence, riparian zone?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!