1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
14

2 - 16x = 6(-3x + 2)=​

Biology
2 answers:
Marina86 [1]3 years ago
8 0
Answer: 6

Step-by Step Explanation: Refer to image
V125BC [204]3 years ago
6 0
The answer is 5 because you have to multiply the parenthesis by 6
Then you move the terms
Then you collect the terms
Then subtract the numbers
Last divide by both sides
You might be interested in
The binding of Ach to its muscuranic receptors indirectly affects the permeability of _____ channels which can produce hyperpola
MArishka [77]

Answer:

The binding of ACh to the muscarinic receptor indirectly affects the permeability of K⁺channels. This can produce hyper polarization in some organs if channels are opened, and depolarization in others if channels are closed.

Explanation:

For example, in the heart it is the beta-gamma compound that fixes to the K+ channels of heart muscle and sources them to exposed. This leads to K+ dispersion out of the cell and the cell converts into hyper polarized consequential in a reduction in heart rate. In contrast, in smooth muscle of the stomach the alpha sub unit fixes to K+ channels producing them to close. This decreases the external diffusion of K+ and the cell converts depolarized ensuing in smooth muscle contraction.

3 0
3 years ago
What is the relationship between undisturbed sedimentary rock layers and fossils?
Juli2301 [7.4K]

Answer:

Older fossils are found in deeper layers of sedimentary rock.

Explanation:

The relationship between undisturbed sedimentary rock layers and fossils is that older fossils are found in deeper layers of sedimentary rocks.

This is one of the premise of the law of superposition and principle of fossil and fauna succession.

  • An undisturbed sequence is one in which the sedimentary layers have been arranged sequentially.
  • The oldest is at the bottom and the youngest on top.
  • Also, fossils grade in this manner too.
  • The oldest fossils will be in the oldest bed which is the deepest layer.
  • The youngest bed will contain the youngest fossils in like manner too.
7 0
3 years ago
Need help asap can't figure out the answer​
Leokris [45]

answers for vocabulary:

1) polar

2) non- polar

3)non- polar

4) polar

please ,put the questions

clearly

7 0
3 years ago
Both renewable and nonrenewable resources are used within our society. How do the uses of nonrenewable resources compare to the
natima [27]
I would say that the most correct statement is the following one:
Certain types of renewable energy can be used for as many applications as certain types of nonrenewable resources.

Let's take for example the energy from solar panels (the renewable energy source) and the energy from burning fossil fuels: this energy can be used in the same situations!

8 0
3 years ago
Read 2 more answers
When looking at the Easter Island case study, what is the biggest lesson we can take away?<br>​
brilliants [131]

Answer:

k

Explanation:

4 0
3 years ago
Other questions:
  • I need help &gt; &lt; i think the answer is C
    10·1 answer
  • All phases of matter may have a fixed mass
    14·1 answer
  • Describe something you use every day that<br> was developed as a result of space<br> exploration.
    6·1 answer
  • What things made of atoms do you see in the video
    13·2 answers
  • Two potential devices that eukaryotic cells use to regulate transcription are
    14·1 answer
  • Which of the following describes a type of bacteria that is pathogenic?
    12·1 answer
  • Animals return water to the air through
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following is an example of succession?
    7·1 answer
  • The freezing point of a 1 m solution of f e c l 3 is expected to be choose. That of a 1 m solution of glucose. This is because f
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!