1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serg [7]
3 years ago
9

What happens when oceanic crust collides with continental crust at a plate boundary?

Biology
2 answers:
tankabanditka [31]3 years ago
8 0

Answer:

the answer is b

Explanation:

antoniya [11.8K]3 years ago
3 0
 Oceanic crust<span>tends to be denser and thinner than </span>continental crust<span>, so the denser </span>oceanic crust<span> gets bent and pulled under, or subducted, beneath the lighter and thicker </span>continental crust<span>. This forms what is called a subduction zone. The answer is B.</span>
You might be interested in
Tubelike cells that carry food from the leaves to other parts of the plant are called?
luda_lava [24]
The answer is phloem
3 0
3 years ago
Read 2 more answers
What process was given as an example of the violation of Mendel's second law?
ANTONII [103]

Answer:

Linkage.

Explanation:

The Mendel's second law is also known as the law of independent assortment. According to this law, the assortment of two different genes are independent of each other.

The law of independent assortment is applicable only when the two genes are on the different chromosomes. If the two genes are on the same chromosome, they undergo the process of linkage and do not assort independently. The linkage will result in the formation of recombinant progeny.

Thus, the correct answer is option (c).

5 0
4 years ago
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
Pani-rosa [81]
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
4 0
4 years ago
What happens when an antibody binds an antigen
tankabanditka [31]

Answer: IT CAUSES PATHOGENS TO STICK TOGETHER

Explanation:

7 0
3 years ago
Read 2 more answers
Between which of the following points would we be able to calculate the displacement of the butterfly? a. A-B b. A-F C.AG​
serious [3.7K]
The answer is most likely to be AG
5 0
3 years ago
Read 2 more answers
Other questions:
  • Why should a person who sells fish and fish aquaria learn about the excretory systems in animals?
    14·1 answer
  • Which layer of the eye contains an extensive blood supply?
    5·1 answer
  • A testcross is a mating between an individual with a dominant phenotype (but unknown genotype) and __________
    5·1 answer
  • In the body of a human or other complex organism, a group of similar cells performing similar functions is called a/an
    15·1 answer
  • What does the nucleus consist of
    15·2 answers
  • Current estimates suggest the number of prokaryotic organisms associated with the human body is equal to or greater than the num
    12·1 answer
  • What type of age structures is typical for a population that is elderly and shrinking?​
    12·1 answer
  • Local factors are important for regulating blood flow to tissue capillary beds. For example, in skeletal muscle tissue that is a
    10·1 answer
  • 3. Wilson planted some seeds that he found in his mom's gardening
    10·1 answer
  • Overall, how much has the temperature of the earth increased?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!