1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
3 years ago
9

Please help... Only numbers 4,5 and 9

Biology
1 answer:
Alex73 [517]3 years ago
4 0
4:
Independent Variable: Photosynthesis
Dependent Variable: Starch

Starch is a product of photosynthesis. Without photosynthesis, starch cannot form. Therefore starch is dependent on photosynthesis.

5:
Independent Variable: Temperature
Dependent Variable: Animal Metabolism

Animal metabolism will only be affected if the temperature of the room changes. Therefore animal metabolism is dependent on temperature.

9:
Independent Variable: Rainfall
Dependent Variable: Thickness of growth rings

The thickness of the tree's growth rings are determined by the amount of rainfall. Therefore the thickness of growth rings are dependent on rainfall.
You might be interested in
Signal transduction is the process by which:
scoundrel [369]

Answer:

An extracellular molecule activates a membrane protein, which in turn activates molecules inside the cell.

Explanation:

Signal transduction may be defined as the cellular process in which the signal is transmitted into the cells. The signal transduction results in the detection of the stimuli and the effects generated in the body.

The signal transduction initiates the series of cascade for the signal transmission. The protein is activated by the extracellular molecule and activates the different molecules by the phosphorylation at the different steps of the transduction.

Thus, the correct answer is option (c).

6 0
3 years ago
Describe the microscopic features of osseous tissue that help long bones withstand stress without breaking.
frozen [14]
Compression and stretching are actually caused by the stress on the both.
Compression happens on the side of impact and Stretching happens ont he side opposite to that of the impact.
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Would solar radiation impact other organisms besides humans? Give an example.
11111nata11111 [884]

Answer: Plants

Explanation: Less solar radiation would mean less sunlight for photosynthesis which means that they won't get enough energy for survival and might die out.

4 0
3 years ago
Read 2 more answers
Different species of bumblebee compete for flower nectar in their ecosystem.
tresset_1 [31]
If there is limited of food then they will compete but if there is an equal amount of food they won’t compete. So the answer is true.
5 0
2 years ago
Read 2 more answers
Other questions:
  • Which layer of the earth contains granite and basalt in the GREATEST abundance
    6·2 answers
  • Importance of protein in mammals​
    9·1 answer
  • which of the following statements can be made about the parallelogram shown below note that the figure is not drawn to scale
    10·1 answer
  • Which question is testable?
    14·2 answers
  • Which scientist revolutionized the way biologists think about the evolutionary history of eukaryotes?
    8·2 answers
  • A compound will have a covalent structure if it is made from?
    8·1 answer
  • What are three different colors of flowers commonly found on an ofrenda de muertos?
    6·2 answers
  • Will try to give brainliest PLEASE HELP ASAP
    10·2 answers
  • Why are stem cells important?
    7·1 answer
  • Since i'm so du/mb, and forgot what newtons 2nd law was can someone explain?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!