1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRISSAK [1]
3 years ago
8

Signal transduction is the process by which:

Biology
1 answer:
scoundrel [369]3 years ago
6 0

Answer:

An extracellular molecule activates a membrane protein, which in turn activates molecules inside the cell.

Explanation:

Signal transduction may be defined as the cellular process in which the signal is transmitted into the cells. The signal transduction results in the detection of the stimuli and the effects generated in the body.

The signal transduction initiates the series of cascade for the signal transmission. The protein is activated by the extracellular molecule and activates the different molecules by the phosphorylation at the different steps of the transduction.

Thus, the correct answer is option (c).

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
The cell membrane is a highly selective barrier that controls the movement of substances in and out of the cell. In fact, polar
Lapatulllka [165]
Im going to have to go with C. they pass through channels in the cell membrane
5 0
3 years ago
Read 2 more answers
Salt is made up of a atom of sodium and a atom of chlorine. True or False
givi [52]
The statement is true. This is because the chemical formula for a salt compound (a compound is made up of two or more atoms of elements) is NaCl, where Na is Sodium, and Cl is Chlorine. Hope this helps!
4 0
3 years ago
????????????????????
qaws [65]

Answer:

uh i mean mushroom

Mushroom = fungi protisty

4 0
3 years ago
Read 2 more answers
What is the boiling point of 2 cups appear of tap water with one tablespoon of salt
r-ruslan [8.4K]
The boiling point of tap water is 100 degrees C (not Farenheit).With a tablespoon of salt, it would be slightly warmer than that.
 I hope I helped. God bless!
4 0
3 years ago
Other questions:
  • Two genes, A and B, are located 30 map units apart. A mating between an individual homozygous dominant for both traits and one h
    14·1 answer
  • Cytotoxic T cells ________. self-destruct once the antigen has been neutralized require the double recognition signal of class I
    14·1 answer
  • 3 ways in which the female pelvis is different from male
    6·1 answer
  • Which is one purpose of cell division?. . A.. to create proteins. . B.. to expend energy. . C.. to help the organism grow. . D..
    7·1 answer
  • What are the three most commonly used instruments for the determination of free-living physical activity and energy expenditure?
    10·1 answer
  • Dose learing play a role in innate behaviors
    15·1 answer
  • mitosis A division happens in the next step. Which describes the cells after the next step is complete? A. The cells will have n
    13·1 answer
  • Yea I need help with this help
    10·2 answers
  • Acceleration is equal to the initial velocity minus the final velocity, then divided by time.
    10·1 answer
  • Does anyone know how to do this
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!