1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
14

only a small percentage of all consumers are specialists. what danger does a specialists face that's generalist does not?

Biology
1 answer:
Temka [501]3 years ago
8 0
Generalist species are adapt to live in a wider range of environment conditions. Specialist species are adapt to live in a narrow range of environment conditions. Thus, specialists are in a greater danger if some of the conditions in the environment change. For example, species A and B live in a river with an average temperature of 17°C. Species A is the generalist species and it can survive water temperature of 5-35°C. Species B is the specialist species and can survive water temperature of 15-20°C. If the temperature of the river decrease to 10°C, specialist species B will not survive but generalist species a will survive.
You might be interested in
What percentage of the earth is covered by water?
Strike441 [17]
75% i think. sdfghjkl;
3 0
4 years ago
Read 2 more answers
What sequence correctly describes the route that an egg takes through the female reproductive system? (2 points). A.Cervix – fal
Charra [1.4K]
The sequence that correctly describes the route that an egg takes through the female reproductive system would be option d. Ovary - Fallopian tube - Uterus. The mature egg is released by the ovary into the Fallopian Tube. Once it is fertilized, it is embedded in the wall of the uterus and this is where the unborn baby develops. If fertilization does not happen, the endometrium is broken down, which results in menstruation.
8 0
3 years ago
Read 2 more answers
What is the name of the bond that is created when two amino acids join?
GaryK [48]

Answer:

The answer is Peptide bond

Explanation:

Amino acids join together to create peptides and peptides join together to create proteins.

8 0
3 years ago
"Apo-repressor of trp operon is an inactive form of repressor." Justify this statement.Select one of the options below as your a
makvit [3.9K]
If im corrrect it should be C)

4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • Can someone plz help me!!!!!!!!????!!!!!!
    12·1 answer
  • Assuming that it will rain when the sky is cloudy and dark is an example of a(n) _____.
    14·2 answers
  • Which statement correctly explains why the smooth ER is considered smooth? It is not responsible for assembling proteins. It doe
    9·2 answers
  • What happens whenever the temperature drops suddenly ​
    15·1 answer
  • What is shown in the image
    12·1 answer
  • Which event has to proceed all others during endochondral ossification?
    14·1 answer
  • Which temperature listed below allows for the greatest rate of photosynthesis? Use the graph below to determine the answer.
    11·1 answer
  • Where is the cell located in the human body? <br><br><br><br> i just wanna make sure.... :)
    9·1 answer
  • How might long-term climate change affect the behavior of migratory birds that nest in the Arctic tundra?
    6·2 answers
  • Which equation is correct according to ohm’s law? r = vi v = i over r. r = i over v. v = ir
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!