1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
12

A species of starfish preys on sea urchins and mussels. If the starfish is removed from the ecosystem, the mussel population exp

lodes uncontrollably, outcompeting most other species for rersources. The urchin population grows and destroys coral reefs. The starfish in this ecosystem is an example of:
Biology
1 answer:
RoseWind [281]3 years ago
4 0

Answer:

The starfish is ecosystem balancer

Explanation:

You might be interested in
There are three major types of cells in the lymphoid tissues of the body. One category, the ____________, contains immunocompete
KonstantinChe [14]

Answer:

See the picture attached

Explanation:

5 0
3 years ago
How can you tell if a protist belongs to eubacteria or archaebacteria?
zhuklara [117]
Protists are unicellular eukaryotes, whereas Eubacteria and Archaebacteria are unicellular prokaryotes.
Eubacteria and Archaebacteria belong to kingdom Monera; whereas Protists belong to kingdom Protista.
All Monerans have prokaryotic cell structure. Protists have eukaryotic cell structure and are unicellular.
Protists either lack cell wall or have cell wall made up of cellulose.
Eukaryotes have cell wall made up of peptidoglycan or murein.
In Archaebacteria cell wall lacks peptidoglycan but contains proteins and non-cellulosic polysaccharides.
Protists have typical sexual reproduction involving fusion of gametes. In Eubacteria and Archaebacteria typical sexual reproduction is absent.
Cell division is mitotic type in Protists and amitotic in Eubacteria and Archaebacteria.
5 0
3 years ago
Review the many ways in which microbes process oxygen by completing each sentence. then, please arrange the sentences in a logic
siniylev [52]

1. With respect to oxygen requirements, an <u>aerobe </u>can use gaseous oxygen and possesses enzymes to process toxic oxygen products.

<h3>What are enzymes?</h3>

Proteins called enzymes aid in accelerating our bodies' chemical reactions, or metabolism. Some compounds are created, while others are broken down. Enzymes are a component of all life. Enzymes are created by our bodies spontaneously.

2.  Expanding on this classification, an <u>obligate </u>aerobe cannot grow without oxygen.

3. Still other organisms, called<u> facultative anaerobes</u>, metabolize by aerobic respiration but can adapt to anaerobic environments.

A facultative anaerobic organism is one that can switch from aerobic respiration to fermentation in the presence of oxygen to produce ATP.

For more information regarding enzymes, visit:

brainly.com/question/1596855

#SPJ1

4 0
1 year ago
SOMEONE PLEASE ANSWER THIS, it’s about caves
Vera_Pavlovna [14]

This is all i know about caves: Caves are large, natural holes beneath the surface of the earth. Underground passages and caves are found in rocky landscapes across the world. They are found in areas with a lot of limestone, a common type of rock. They can be created in various ways, but most caves are hollowed out of rock by water.

8 0
2 years ago
Read 2 more answers
What do you think a geological process is
agasfer [191]
Geological processes are events that occur on a geological timescale ranging between millions of centuries, hundreds of meters, and thousands of kilometers. Compare this to the everyday models from physics and engineering operated at laboratory units an
4 0
3 years ago
Other questions:
  • Maple trees are often tapped to extract the sap to make syrup. Which type of tissue is the aim of the tree tap?
    12·1 answer
  • In terms of topography, the deepest soils are ________
    6·1 answer
  • How to figure out the inclination of the earths axis
    7·1 answer
  • The higher up on a cladogram animals are
    10·1 answer
  • Describe two ways cross-pollination can take place.
    6·1 answer
  • You are studying a new species of eukaryotic microorganism, and observe by microscopy that its nucleus contains exactly 2 linear
    12·1 answer
  • How many significant figures are in the measurement 50.003010 nm?
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which is an example of a natural disaster that would threaten the survival of
    10·2 answers
  • Answer and i will give brainly
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!