<span>what really led into that was most likely the evolution period, all of the reptiles were subdivided into noticeable stages
</span>
Answer:
The correct answer is 4.ecosystem.
Explanation:
An ecosystem is a system, that is, a set of elements that interact with each other, in which such elements are: physical environment, living beings and their interactions (predator-prey, parasite-host, competition, symbiosis, pollination, distribution of seeds , etc.) The interrelation between living beings (competition, parasitism, etc.) occurs through cycles of matter and energy flows on which the functioning of the entire ecosystem depends.
Answer:
it’s in spanish not sure many people will understand itb
Explanation:
Well,
By the word "deletion" we can deduce that information is lost. Therefore, when a chromosome undergoes a deletion mutation, information is lost. This can have disastrous effects if it is a human chromosome.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved