All categories

2 years ago

The data in the graph are the result of a paramecium being placed in a hypertonic salt solution.

Biology

2 answers:

ad-work [718]2 years ago

8 0

Answer:

A. Replace the concentration descriptions with actual values.

Explanation:

did it on edg2020

leonid [27]2 years ago

3 0

Answer:

Replace the concentration descriptions with actual values.

Explanation:

A graph is used to convey real, accurate and objective information. The use of the description of the concentrations in place of the real values, does not represent an accurate information, but a subjective and imprecise information. For this reason, to improve the quality of this graph and allow the readers to fully understand it, it would be necessary to replace the descriptions of concentration with real values.

You might be interested in

What most likely led directly to the appearance of reptiles during the Carboniferous Period?

Vikentia [17]

<span>what really led into that was most likely the evolution period, all of the reptiles were subdivided into noticeable stages

</span>

3 0

2 years ago

Read 2 more answers

A(n)\ is a system composed of living organisms and their interaction with the surrounding environment, where the main focus is t

vova2212 [387]

Answer:

The correct answer is 4.ecosystem.

Explanation:

An ecosystem is a system, that is, a set of elements that interact with each other, in which such elements are: physical environment, living beings and their interactions (predator-prey, parasite-host, competition, symbiosis, pollination, distribution of seeds , etc.) The interrelation between living beings (competition, parasitism, etc.) occurs through cycles of matter and energy flows on which the functioning of the entire ecosystem depends.

7 0

2 years ago

What does the image refer to?

Leona [35]

Answer:

it’s in spanish not sure many people will understand itb

Explanation:

6 0

2 years ago

Read 2 more answers

When a chromosomes undergoes a deletion mutation, information is ?

Readme [11.4K]

Well,

By the word "deletion" we can deduce that information is lost. Therefore, when a chromosome undergoes a deletion mutation, information is lost. This can have disastrous effects if it is a human chromosome.

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago