1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
2 years ago
12

Compared to humans, elephants have a dramatically low instance of cancer. Elephants have multiple copies of the

Biology
1 answer:
Yanka [14]2 years ago
6 0

Elephants have multiple copies of the p53 genes that play an important role in the control of cell division.

<h3>What is the role of p53 genes in elephants?</h3>

P53 is an important regulator of the DNA repair processes and controls uncontrolled cell proliferation. When DNA is harmed, the protein becomes active and aids in orchestrating a response that stops DNA replication and fixes any incorrect copies of the cell. The oncogene MDM2 E3 ubiquitin ligase, another protein, is responsible for deactivating the p53 repair activity in duplicated cells with intact DNA since it is not required.

A human with only two alleles from a single gene has much fewer molecular anti-cancer interactions than an elephant, which has 40 alleles, or versions, from its twenty p53 genes. Although the elephant may appear to have excessive genetic diversity, each of its 40 alleles is structurally slightly different.

I understand the question you are looking for is this:

Compared to humans, elephants have a dramatically low instance of cancer. Elephants have multiple copies of the _____ genes that play an important role in the control of cell division.

Learn more about p53 genes here:

brainly.com/question/19581609

#SPJ4

You might be interested in
Fuel rods in the reactor vessel are made of ______
kkurt [141]
Uranium Is Made In Fuel Rods In The Reactor Vessel

6 0
3 years ago
Read 2 more answers
Arborviral diseases: Group of answer choices Refer to arthropod-borne viral diseases Can produce central nervous system illness
notsponge [240]

Answer:

All of the options are correct.

Arboviral diseases are arthropod borne, they can produce central nervous system illnesses, transmitted by mosquito bites and also produce acute self limiting fevers.

Explanation: Arboviruses are viruses that are harboured by arthropods which includes mosquitoes, they have the capacity to cause illnesses which are acute and self limiting(it has the ability to resolve on its own without treatment). It has also been found to cause illnesses to the central nervous system(the brain and the spinal cord).

6 0
4 years ago
What is the primary function of the carbon cycle
wlad13 [49]

The carbon cycle maintains the balance between the organic remains and carbon dioxide. In this cycle the the incorporation of carbon dioxide inside the plants by photosynthesis occurs and it is returned to the atmosphere by the process of respiration as well as the decaying dead organisms.

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What are three ways body systems work together to maintain homeostasis?
mafiozo [28]

Answer:

Each organ system performs specific functions for the body, and each organ system is typically studied independently. However, the organ systems also work together to help the body maintain homeostasis.

For example, the cardiovascular, urinary, and lymphatic systems all help the body control water balance. The cardiovascular and lymphatic systems transport fluids throughout the body and help sense both solute and water levels and regulate pressure. If the water level gets too high, the urinary system produces more dilute urine (urine with a higher water content) to help eliminate the excess water. If the water level gets too low, more concentrated urine is produced so that water is conserved. The digestive system also plays a role with variable water absorption. Water can be lost through the integumentary and respiratory systems, but that loss is not directly involved in maintaining body fluids and is usually associated with other homeostatic mechanisms.

Similarly, the cardiovascular, integumentary, respiratory, and muscular systems work together to help the body maintain a stable internal temperature. If body temperature rises, blood vessels in the skin dilate, allowing more blood to flow near the skin’s surface. This allows heat to dissipate through the skin and into the surrounding air. The skin may also produce sweat if the body gets too hot; when the sweat evaporates, it helps to cool the body. Rapid breathing can also help the body eliminate excess heat. Together, these responses to increased body temperature explain why you sweat, pant, and become red in the face when you exercise hard. (Heavy breathing during exercise is also one way the body gets more oxygen to your muscles, and gets rid of the extra carbon dioxide produced by the muscles.)

7 0
3 years ago
Read 2 more answers
Other questions:
  • Global fossil fuel dependence can lead to an increase in oil prices.
    14·1 answer
  • The focus of the earthquake is the
    7·1 answer
  • 1: How many different kinds of amino acids can be carried by tRNA molecules?
    5·1 answer
  • Why would certain substances in the urine be an important diagnostic tool?
    12·1 answer
  • If all of the grasshoppers died or left the area suddenly, what impact would that have on this ecosystem's food web? Answer by n
    11·1 answer
  • People are often reminded to conserve water. Explain why we should conserve water if water is never lost but is constantly recyc
    5·2 answers
  • Name the two kinds of particles that make up a water particle
    11·2 answers
  • Since invasive species did not co-evolve with the other species in the ecosystem where they were introduced _______. a. they can
    7·2 answers
  • A leech attaches to an animal and feeds off the animal's blood.
    13·2 answers
  • What event is most likely to occur to the brain in a classic cerebral concussion?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!