1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
12

What substances are produced by cellular respiration?

Biology
1 answer:
saw5 [17]3 years ago
8 0

Answer:

CO2 and H2O is correct and now I just have to fill space sooooo

You might be interested in
What invention in the 1400’s revolutionized the way knowledge could be spread?
Neporo4naja [7]

Movable-type printing was the invention in the 1400’s revolutionized the way knowledge could be spread.

<h3>What is Movable-type printing?</h3>

This type of printing involves the use of movable components to reproduce elements and letters on paper.

This was adopted by churches through printing of bible and other religious materials and led to the protestant reformation in the 1400s

Read more about Printing here brainly.com/question/12336191

#SPJ1

5 0
1 year ago
The Animalia, Plantae, and Protista are _____.<br> domains<br> kingdoms<br> phyla<br> classes
UkoKoshka [18]
The correct answer is kingdoms
5 0
3 years ago
Read 2 more answers
Put these in order from smallest to largest: neuron, cell, synapse
vladimir1956 [14]

Answer:

, cell, Synapse,  Neuron,

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following situations does not call for adjusting your lane position?
arlik [135]
A. The car ahead of you is turning
3 0
3 years ago
Read 2 more answers
Need help on 9 and 10
jenyasd209 [6]
9. 1 Hudson highlands andadinorack mountains
10.4 rock salt
4 0
3 years ago
Other questions:
  • Cameron was given the following series of observations. Which represents a theory?
    7·2 answers
  • If there are 3 different alleles for a particular gene in a population of diploid organisms, how many different genotypes are po
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Select all that apply. An ideal gas _____. does not exist perfectly obeys all gas laws only exists at very low temperatures only
    8·2 answers
  • Which is not caused by bacteria?
    13·2 answers
  • Which life-form existed on Earth for the shortest period of time?
    12·2 answers
  • Hikers are attempting to cross the arizona desert with a small supply of water. the temperatures cause them to sweat profusely a
    14·1 answer
  • A group of organisms that are all the same species is call a(n)
    5·2 answers
  • I need help <br> A)16<br> B)9<br> C)3<br> D)6
    10·1 answer
  • What is the term for the application of scientific information?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!