Earths own loop cycle is some arguments I’ve heard.
The glucose required for cellular respiration is produced by plants. Plants go through a process known as photosynthesis. ... This energy is then converted along with water and carbon dioxide from the atmosphere into glucose and oxygen. <em>Photosynthesis</em>. ... During photosynthesis, plants absorb sunlight and carbon dioxide from the air. Through a series of steps, much like cellular respiration, they convert these reactants into the products oxygen and glucose. The plants then can use the oxygen and glucose to make ATP in cellular respiration
Answer:
The correct answer is - end of cytokinesis.
Explanation:
Cytokinesis :- a procedure that partitions the cytoplasm and plasma layer of a cell, bringing about two indistinguishable cells that contain their own DNA, nucleus, nuclear membrane, and plasma membrane.
During the last phase of the cell cycle, cytokinesis permits the cell to complete the process of isolating, making two cells with indistinguishable duplicates of DNA
The cell squeezes in the equator area with the assistance of a ring of contractile protein filaments. The formed cleavage furrow develops until the two cells squeeze off totally.
Thus, the correct answer is - end of cytokinesis.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
A drug that interacts directly with receptor sites to cause the same activity that a natural chemical would cause at that site is the instructors best response.
Explanation:
Receptors are Macromolecules which involved in chemical signalling within cells. It is possible that receptors are located in the cell surface membrane. Cellular biochemical process is regulated by Activated receptor. The drugs are capable to affect to receptor who is related to the drug’s affinity and also intrinsic efficacy.
The affinity and activity of drug is related to its chemical structure. its effect is decided by the time duration where complex persistence of drug-receptor.
