This is a case of a patient with right sided thoracic myofascial (involving the muscles and the overlying fascia) pain involving 3 muscle groups that was injected with a local anesthetic (Bupivacaine) which are rhomboid major, rhomboid minor, and levator scapular muscles. The CPT code involving trigger point injections of 3 or more muscle groups is CPT 20553.
Answer: They may be prokaryotic is false.
Explanation:
Protists are eukaryotic organisms i.e they have membrane bound organelles and Nucleus. They are neither plants,animals or fungus. Protists have many form of nutrition and they may be aerobic or anaerobic.
Some protists photosynthesized like algae while others are heterotrophs
They may be unicellular or multicellular.
Some protists have cell walls while others don't.
Hey there! The last part of the digestive system is answer choice B. Large intestine.
Hope this helps! :)
I think yes but im just answering to ask a question sorry
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
