1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
3 years ago
11

Match the following. Match the items in the left Colin to the items in the right column.

Biology
1 answer:
zepelin [54]3 years ago
4 0
<h2>Hello my dear mate!! </h2>

Answer:

<em><u>All</u></em><em><u> </u></em><em><u>that</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>have</u></em><em><u> </u></em><em><u>matched</u></em><em><u> </u></em><em><u>is</u></em><em><u> </u></em><em><u>correct</u></em><em><u>.</u></em><em><u> </u></em><em><u>☑</u></em><em><u>✔</u></em><em><u>✔</u></em><em><u>✔</u></em>

Explanation:

✌Hope it helps ❣

❤<em><u>Follow</u></em><em><u> </u></em><em><u>me</u></em><em><u> </u></em><em><u>❤</u></em>

<em><u>and</u></em><em><u> </u></em><em><u>mark</u></em><em><u> </u></em><em><u>my</u></em><em><u> </u></em><em><u>answer</u></em><em><u> </u></em><em><u>as</u></em><em><u> </u></em><em><u>brainliest</u></em><em><u> </u></em><em><u>✌</u></em>

You might be interested in
Which of the following statements is true?
dimaraw [331]

Igneous rocks are classified by particle size


6 0
3 years ago
Read 2 more answers
How many sugar molecules make up simple carbohydrates?
nataly862011 [7]
Answer:
One or two molecules can make up simple carbohydrates
8 0
3 years ago
Read 2 more answers
Define and give an example for the term; <br><br> Prey <br><br> definition for biology
Alexandra [31]
Prey or predation is a biological interaction where a predator (an organism, often an animal) kills and eats its prey (another organism). 

Like a mouse getting caught and eaten by a bird of prey (Eagles, hawks, etc.)
6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Mitochondria and chloroplasts are thought to have been ______.
yawa3891 [41]
Mitochondria and chloroplasts likely evolved from engulfed prokaryotes that once lived as independent organisms.
(At some point, a eukaryotic cell engulfed an aerobic prokaryote, which then formed an endosymbiotic relationship with the host eukaryote, gradually developing into a mitochondrion. Eukaryotic cells containing mitochondria then engulfed photosynthetic prokaryotes, which evolved to become specialized chloroplast organelles).
6 0
3 years ago
Read 2 more answers
Other questions:
  • How has nearly all the food we eat been "genetically modified" in the broadest sense of the term?
    15·1 answer
  • If three children are born to Matthew and Jane, what are the chances that the first two children will not express the trait but
    14·1 answer
  • The largest diversity of plants and animals on the planet is found in one terrestrial biome.   Please select the best answer fro
    7·2 answers
  • What are steroid hormones most similar to?
    7·2 answers
  • There are two main ways in which molecules are transported into and out of cells, active transport and passive transport. Which
    7·2 answers
  • The domestication of animals came before the cultivation of plants in human history
    7·1 answer
  • The muscle tissue in your heart is made up of what
    15·1 answer
  • One species called the naked mole-rat, has some unique differences. They have a social structure similar to that of ants and bee
    6·1 answer
  • Heat from the sun travels to earth by what
    8·1 answer
  • Access of therapeutic drugs to the central nervous system is restricted compared to that of other tissues because of the presenc
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!