1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
13

What happens to most of the light energy during photosynthesis?

Biology
1 answer:
Zanzabum3 years ago
3 0

Answer:

uses the energy of sunlight to convert water and carbon dioxide (reactants) into high-energy sugars and oxygen (products).

Explanation:Summarize what happens during the light-dependent reactions of photosynthesis. ... NADP+ molecules pick up the high-energy electrons along with H+ ions to become NADPH.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Im confused on this can anyone help?
Alex_Xolod [135]

Answer:

me to

Explanation:

i have that same problem its to hard

5 0
2 years ago
What characteristic of amphibians necessitates that they live near water?
Alinara [238K]
They are mostly habittated to watter because they requres oxygen more from water or there organ setup to do it works properly under water.
5 0
3 years ago
write a 5-7 sentence paragraph explaining what happens to co2 levels in the world over the course of the year. add as much conte
Hunter-Best [27]

Answer:

The amount of CO2 found in the atmosphere varies over the course of a year. Much of this variation happens because of the role of plants in the carbon cycle. Respiration happens all the time, but dominates during the colder months of the year, resulting in higher CO2 levels in the atmosphere during those months.

Explanation:

4 0
2 years ago
Hello?? Can anyone help me??! PLEASE
kolezko [41]

Answer:

The temperature is staying the same. In the graph when it shows solid/liquid and liquid/gas, the temperature stays the same until it changes. This is because it reached it's melting point/vaporizing point. For example, a solid gets heated up, it then reaches it's melting point but it can't go higher than that because it isn't fully a liquid yet, once it's a liquid it will then continue to rise in temperature.

I don't think I put enough detail into that explanation but I hope this helps your problem.

4 0
2 years ago
Other questions:
  • What objective should you use when you are first searching for an object on a slide?
    7·1 answer
  • The Canada goose and its subspecies may be undergoing _______, the process of new species forming or becoming distinct.
    10·1 answer
  • Which of the following statements best explains why the cube in image b is under more pressure than the cube in image a
    12·1 answer
  • If DNA can be described as the instruction book for building an organism, which phrase best describes a gene?
    8·1 answer
  • Which label belongs in the area marked X?
    8·2 answers
  • If all of your cells have the same DNA, how is it possible for one of
    12·1 answer
  • Of the earth's liquid water, most of the freshwater is stored in the form of ________.
    11·1 answer
  • A theory by which prokaryotes gave rise to the first eukaryotic cells. Chloroplasts in plants and mitochondrion in other eukaryo
    12·1 answer
  • What threatens the existence of a chimpanzee species?
    5·2 answers
  • Please help me I don’t understand this. Look at photo
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!