1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
10

Most people experience increased infant mortalities at high altitudes. Explain how a mutation that allows normal levels of infan

t survival at high altitudes would spread through a human population that had just begun living high in the mountains. Make sure to include the concepts of variation, selection, and inheritance in your explanation.
Biology
1 answer:
solmaris [256]3 years ago
6 0

Answer:

Most people experience increased infant mortalities at high altitudes due to the inability of the mother to provide sufficient oxygen to the developing fetus but now variation in the DNA sequence in the people that lives at higher altitudes like in Tibetans allow normal level of infant survival at high altitudes.

This variation occurred in the EPAS1 gene in the Tibetan population that is responsible for delivering oxygen more efficiently to the fetus. This nucleotide variation is also present in low landers of Beijing but natural selection selected the variant gene in Tibetan people because they require this mutated gene for their survival.  

So the population passed this variant gene in next-generation, therefore, inheritance allowed the spreading of the mutated gene to the next generation therefore by natural selection and inheritance a mutated gene spread through a human population that had just begun living high in the mountains.

You might be interested in
9. in your own words compare and contrast cell division in prokaryotes and eukaryotes
Ivanshal [37]

Answer:

Cell division is simpler in prokaryotes than eukaryotes because prokaryotic cells themselves are simpler. Prokaryotic cells have a single circular chromosome, no nucleus, and few other cell structures. Eukaryotic cells, in contrast, have multiple chromosomes contained within a nucleus, and many other organelles.

4 0
3 years ago
Not all members of a species are the same. Every species exhibits . For example, some beetles are green, while others are brown.
Svetradugi [14.3K]

Answer:

leaves

Explanation:

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What happens when an aerobic organism is placed in an anaerobic environment?
galina1969 [7]
The answer u r looking for is- B, The electron transport chain stops, stopping the citric acid cycle. Hope I’ve helped ;)
5 0
3 years ago
Read 2 more answers
Many farmers in less densely populated areas, such as amazonia, practice _______________, also known as shifting cultivation or
Norma-Jean [14]
Many farmers in less densely populated area, such as Amazonia, practice slash and burn agriculture, also known as shifting cultivation or swidden agriculture where an area is cleared and then burned for the vegetative remains to release nutrients back into the soil. Shifting cultivation is a system where a farmer uses a piece of land, only to abandon or alter the initial use a short time later. Advantages of shifting cultivation includes; enhance control of pest and disease, inorganic matter addition which provide nutrient to crop, an effective way of weed control
7 0
3 years ago
Other questions:
  • Babies at high risk for stunted growth, poor health, and impaired functioning throughout life are dealing with the results of
    6·1 answer
  • ELISA immunoassay experiment
    11·1 answer
  • What type of relationship would a mouse and a rabbit have?
    8·2 answers
  • Which would least likely be a cause of natural selection?
    10·1 answer
  • DUE IN 12 MIN Please help me with these, will mark brainliest
    5·1 answer
  • What is:<br> Behavioral isolation Temporal Isolation <br> Habitat Isolation
    14·1 answer
  • Explain the parts of Darwin’s Theory of Natural Selection.<br> Fake answers will be reported
    8·1 answer
  • Pls help me with this simple problem! tysm!!! &lt;3
    9·2 answers
  • Need help, i will give free cookies &lt;3<br><br><br> - dont guess please-
    6·1 answer
  • Explain why gold can be dug from the ground as pure metal whereas iron is only found as a compound in iron ore
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!