1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetllana [295]
3 years ago
7

According to the oxygen-hemoglobin dissociation curve, PO2 in the lungs of 100 mm Hg results in Hb being 98% saturated. At high

altitude, there is less O2. At a PO2 in the lungs of 80 mm Hg, Hb would be ________ saturated. According to the oxygen-hemoglobin dissociation curve, PO2 in the lungs of 100 mm Hg results in Hb being 98% saturated. At high altitude, there is less O2. At a PO2 in the lungs of 80 mm Hg, Hb would be ________ saturated. 95% 100% less than 50% 98%
Biology
1 answer:
tatiyna3 years ago
8 0

Answer:

95%.

Explanation:

Oxygen-hemoglobin dissociation curve:

Oxygen-hemoglobin dissociation curve is basically a sigmoid curve which relates between the saturation of oxygen (SO2) and partial pressure of oxygen in blood (PO2). It shows the affinity of oxygen with hemoglobin at different temperature and other factors. In the oxygen-hemoglobin dissociation curve; saturated oxygen is ploted on verticle axis and partial pressure of oxygen in mmHg on the horizontal axis.

Here in the above scenario at the high altitude oxygen is less and at 80 mmHg, Hb would be 95% saturated.

You might be interested in
The stethoscope is a device commonly used by doctors to monitor heart function. When listening to a heart beating using a stetho
Effectus [21]

Answer:

The correct answers are:

1. closing

2. the ventricles and arteries,

3. a constricted trachea

Lub is the first sound of a heartbeat and is mentioned as S1. It is usually produced due to the closing of tricuspid and and mitral or bicuspid valves present between atria and ventricles.

Tricupsid is located between atrium and ventricle of the right hand side and mitral valve is located between atrium and ventricle of the left hand side. They prevent the back flow of blood from ventricles to their respective atria.

Dub, being the second sound is written as S2. It is produced due to the closing of pulmonary (located between right ventricle and pulmonary artery) and aortic valves (located between left artery and aorta).

These valves prevent the back flow of blood from arteries into the ventricles.

The time between the two sounds is often taken as the measure of the diastole i.e. ventricular filling.

Wheezing refers to a high-pitched sound produced when a person breathes, especially during exhale. It is caused by constriction of the airways or inflammation. It is considered as a symptom of various diseases such as asthma, COPD, allergies, bronchitis etc.

8 0
3 years ago
10.The bacteria that are capable of converting the atmosphere nitrogen into nitrates and nitrites
kotykmax [81]
It is b your welcome
8 0
4 years ago
If one sample food contains 200 cal in another contains 300 cal, which statement applies?
Advocard [28]

<u>Answer</u>:

The food containing 200 calorie have less potential energy than the food containing 300 calorie

<u>Explanation</u>:

The potential energy content of a food material is its stored energy content which is in the form of chemical bonds. This energy can be measured through the combustion of food material inside a calorimeter. A calorimeter is an instrument which is used to measure the total calorie content of the food or other biological samples by measuring its heat content. A Calorie is unit of energy which is in form of heat.

The food material containing carbohydrates proteins and fats have energy in form of chemical bonds.  On the breaking of bond inside the body, energy is released as in the case of glucose breakdown also known as glycolysis.  

The energy released from glycolysis is used to synthesize high energy containing phosphoanhydride bonds. These ATP molecules are a further breakdown in the system to provide energy to the cell to perform various activities.

6 0
4 years ago
REPOST! Need help please. 1-2 per person that answers.
Vika [28.1K]

Answer:

the limestone is the youngest, and therefore the top most rock layer found at the Grand canyon

6 0
3 years ago
Which of the following distinguishes the 38 organisms in the kingdom Fungi from other Eukaryotic organisms A- Fungi reproduce us
Amanda [17]
<span>Fungi obtain nutrients by absorption</span>
4 0
3 years ago
Other questions:
  • The carboxylation of pyruvate by pyruvate carboxylase occurs at a very low rate unless acetyl-CoA, a positive allosteric modulat
    10·1 answer
  • List two ways by which water can be made safe for drinking
    7·1 answer
  • Drug abuse is defined as __________. A.the consumption of legal drugs for medical purposesB.the consumption of illegal drugs for
    12·1 answer
  • Why do conservationists sometimes purposely set a forest fire?
    9·1 answer
  • Explain why an ecological pyramid is smaller at the top then the bottom
    11·1 answer
  • What is one major difference between viruses and bacteria?
    10·1 answer
  • How many molecules of water are created when making a lipid?
    10·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Researchers returning from the world’s most ambitious study ever of the
    6·1 answer
  • Which of the following is an environmental factor that leads to food insecurity?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!