1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
luda_lava [24]
2 years ago
13

What is composes soil?

Biology
1 answer:
slamgirl [31]2 years ago
4 0

Answer:

Soil is a material composed of five ingredients — minerals, soil organic matter, living organisms, gas, and water. Soil minerals are divided into three size classes — clay, silt, and sand (Figure 1); the percentages of particles in these size classes is called soil texture.

You might be interested in
All genetic mutations reduce a species chances for survival.<br> a. True<br> b. False
kozerog [31]
False. Some Genetic mutations can actually be proven to be very helpful to some species.
6 0
3 years ago
Sally was exposed to hepatitis. Her doctor gave her an injection containing
expeople1 [14]

Answer:

The correct answer is - passive immunity - artificially acquired.

Explanation:

Passive immunity is the immunity that involves giving or acquiring antibodies from other sources instead of developing them on one's own. This type of immunity can be natural and artificial. Mother breastfeed the babies, is the natural passive immunity example as milk also contain antibodies required for immunity of babies.

Artificial passive immunity is the immunity that comes from injecting the antibodies created in different animals or persons which called antiserum or vaccines such as snake antivenom.

5 0
2 years ago
Earth is closest to the sun during the month of January true or false
inna [77]

Answer:

<h2>True</h2>

Explanation:

Earth is closest to the sun every year in early January, when it's <u>winter</u> for the Northern Hemisphere.

good \: luck

5 0
2 years ago
PLEEEASE I NEED HELP!! ASAP
Nutka1998 [239]

The planets appeared to move backward in the sky occasionally.

3 0
3 years ago
Read 2 more answers
What is the ploidy of organisms that have two sets of chromosomes? what is the ploidy of organisms that have two sets of chromos
Sidana [21]
The answer to this question is 2n
5 0
3 years ago
Other questions:
  • What is the chemical made in the stomach that is not an enzyme?
    10·1 answer
  • The enzyme known as ‘catalase’ is involved in the breakdown of hydrogen peroxide molecules into separate water and oxygen molecu
    9·1 answer
  • BIOLOGY DEFINTION Genotype:
    7·2 answers
  • A/an ___________ occurs when a layer of warm air prevents the rising air from escaping. The polluted air is trapped and held clo
    8·1 answer
  • Why is it so important to control the variables
    8·1 answer
  • What are the benefits of the International Space Station? Select all that apply.
    7·2 answers
  • 20 Points thank you! For the real answer people
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The options are: ecosystem, population, food web, or niche
    6·1 answer
  • Is a fly with no wings called a walk?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!