1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ella [17]
3 years ago
10

Choose the correct order for the production and secretion of a protein.

Biology
1 answer:
d1i1m1o1n [39]3 years ago
6 0

Question

Choose the correct order for the production and secretion of a protein.

A. nucleus - rough ER - golgi complex - plasma membrane

B. golgi complex - nucleus - rough ER - plasma membrane

C. Plasma membrane - golgi complex - rough ER - nucleus

D. nucleus - smooth ER - golgi complex - plasma membrane

Answer:

A. nucleus - rough ER - golgi complex - plasma membrane

Explanation:

You might be interested in
A zoologist finds a mysterious worm-like animal, and is trying to identify it. What characteristic would he need to find in the
alukav5142 [94]

to classify it as a protostome, zoologist must see for the mouth development in the embryo.

Explanation:

The protostome are the animals which are unique to their three germ layer in embryonic development, with the bilateral symmetry as they have the ability to fly with other protostome developments.

the one characteristic feature to distinguish them as the protostome, mouth part development is to be sought as the mouth develops but not the anus in the embryo. the mouth parts serves unique to the group and their feeding structures.

5 0
3 years ago
During aerobic respiration, a glucose molecule is disassembled into carbon dioxide and water molecules. What fraction of the car
iris [78.8K]

Two-third fraction of the carbon dioxide molecules released is generated during the citric acid cycle.

Explanation:

Aerobic respiration results in energy production as well as releases the waste products of carbon dioxide plus water.

Pyruvate oxidation during aerobic respiration leads to the production of carbon dioxide and pyruvate is converted into a two-carbon molecule aligned with acetyl CoA.

This compound then proceed to the citric acid cycle, oxidize, and results in the production of two carbon dioxide molecules along with one GTP or an ATP, 3 NADH, and 1 FADH molecule.  

The citric acid cycle or the tricarboxylic cycle is a set of cyclic biochemical reactions taking place in aerobic organisms to oxidize the acetate (acetyl carbon molecules of the acetyl CoA) from proteins, carbohydrates, and fats into carbon dioxide and release energy.

5 0
3 years ago
What would most likely happen to life on Earth if the carbon cycle stopped?
xxMikexx [17]
Poof just like that
everyone
gone
forever
lol
but in all seriousness, human life would cease to exist. 
5 0
2 years ago
What is the function of spongy material called red marrow
djverab [1.8K]
<span>The major function of bone marrow is to generate blood cells and the red is found in flat bones like the hip.</span>
5 0
2 years ago
Read 2 more answers
What do all seed plants use to reproduce
KIM [24]

Answer:

Seed are generated by apomixis which is a form of asexual reproduction.

Explanation:

5 0
2 years ago
Other questions:
  • Decomposer serve a key role in the nitrogen cycle primarily because they
    7·2 answers
  • Peoples choices can have a positive or negative affect on their health describe one positive choice and one negative health choi
    9·2 answers
  • The form of a trait that _____ shows up in an organism when the allele is present. _______________ another trait
    9·1 answer
  • THE FIRST PERSON TO ANSWER ASAP
    6·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Can someone help explain please
    5·1 answer
  • Plant growth is the result of cells dividing during _____.<br> plss help
    14·2 answers
  • Which of the following do most
    6·2 answers
  • A heterozygous white rabbit is crossed with a black rabbit. What is the probability of getting black rabbit offspring?
    10·1 answer
  • What differences would you expect to observe between an igneous intrusion into sedimentary rock and an igneous rock where sedime
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!