1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
9

An atom has an atomic number 17 and atomic mass number 35. How many neutrons are present in its nucleus?

Biology
2 answers:
Andreas93 [3]3 years ago
8 0
There are 17 neutrons.
Alexeev081 [22]3 years ago
7 0
I believe that there are 18 neutrons present in the nucleus.
You might be interested in
A factor that does not change in an experiment is the
Vinil7 [7]
A, because it the constant variable
6 0
3 years ago
Meiosis is a type of cell division that has 2 rounds of division that creates 4 diploid somatic cells that are genetically ident
ohaa [14]

Answer:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells. This process is required to produce egg and sperm cells for sexual reproduction.

Explanation:

there's a better explanation, but I don't know what your question is

3 0
3 years ago
How many half-lives occur in 4 hours?<br> A. 1<br> B. 2<br> C. 3 <br> D. 4
Solnce55 [7]
I believe the answer is C
3 0
3 years ago
Maintenance methylation of dna is rare and highly regulated. true or false
almond37 [142]

false

bcuz it just iz quit askin all those questions mayathay



7 0
3 years ago
How do fungal species help other organisms in their ecosystems?
nignag [31]
Fungal species help other organisms in their ecosystems in many ways,
<span>Fungi are decomposes - they recycle the dead organs.
</span>They also maintain overall stability in ecosystem.
5 0
3 years ago
Other questions:
  • Which of the following terms means a group of connected or related objects or materials
    6·1 answer
  • Which is the name for a change in the environment that causes an organism to change its activity? A. brain B. parasite C. respon
    7·2 answers
  • Describe how viruses and prions can alter cell functions
    12·1 answer
  • Why is it important for scientists to develop a way to grow tissues that have a built-in system to supply blood
    13·2 answers
  • The highest point of a wave is called the
    9·2 answers
  • 3 things plants need.
    13·2 answers
  • Aerobic respiration happens in what cellular organelle?
    11·1 answer
  • Circle the letter of the correct choice.
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Why does parthenogenesis not occur in mammals?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!