1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
6

Which species is an example of an autotroph?

Biology
2 answers:
diamong [38]3 years ago
8 0
<span>Which species is an example of an autotroph?
</span>
d. hawthorne tree
xxTIMURxx [149]3 years ago
4 0
An autotroph is an example of a producer, something that builds its own nutrients from molecules such as carbon dioxide and water. In this case, the correct answer is d. A hawthorne tree uses the process of photosynthesis to produce nutrients such as simple sugars which can then be used to build organic molecules inside the plant to fuel respiration and other biochemical processes. 
You might be interested in
Anaerobic exercise is an intense activity that lasts a short period of time. This
slega [8]
C. In anaerobic exercise muscles do not use oxygen. In aerobic exercise muscle use oxygen.
6 0
2 years ago
2. A living disease carrier is called a: *
adoni [48]

Explanation:

As I think vector is the correct one.

7 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Plzzzzzzzzzzzzzzzzzzzzzzzzzzz help i only need help with B everything eles i can do my self
Nina [5.8K]

Answer:

I believe that it is the lettuce.

Explanation:

it is the fist thing in the graph so it is the start/producer of the chain.

4 0
3 years ago
The coconut palm is now widely dispersed in the world because of ________.
Vedmedyk [2.9K]
Birds because they spread seeds
3 0
3 years ago
Other questions:
  • What is a major difference between facilitated diffusion and active transport?
    11·1 answer
  • 2. Your neighbor cannot understand why her new flowerbed now contains pink flowers. She
    5·1 answer
  • A theory of evolution that states that a species evolves in spurts of rapid change and then goes through periods of no change is
    7·2 answers
  • Use numbers to indicate the order of steps in the pyruvate dehydrogenase complex: 1. _______Decarboxylation of pyruvate to an al
    11·1 answer
  • This is an element in the periodic table that is the basis for all organic molecules
    11·1 answer
  • ASAP PLEASE HURRY
    11·1 answer
  • El oxido de cloro (cio), que tiene un efecto importante en la disminucion de la capa de ozono, se descompone rapida mente a temp
    9·1 answer
  • In the beginning of prophase the DNA coils back up and​
    14·2 answers
  • The use of dna information to direct the production of particular proteins is called
    8·1 answer
  • Clay in soils represents a trade-off in nutrient availability, such that ________.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!