1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
3 years ago
5

As an organism begins to learn more and more about its environment, it will begin to construct a complex mental representation o

f that data called a _____
Latent map
Cognitive redux
Cognitive map
Latent redux
Chemistry
2 answers:
saw5 [17]3 years ago
7 0

Cognitive Map

Explanation:

As an organism begins to learn more and more about its environment, it will begin to construct a complex mental representation of that data called a Cognitive Map

tankabanditka [31]3 years ago
6 0

Answer:

Cognitive map

Explanation:

A cognitive map is a mental representation of one's physical environment.

You might be interested in
In which region are most particles moving the fastest?
tester [92]
Container which is heated
3 0
3 years ago
Read 2 more answers
The mass of an electron is 9.11× 10–31 kg. What is the uncertainty in the position of an electron moving at 2.00 × 106 m/s with
Kruka [31]
Just use the Heisenberg Uncertainty principle: 

<span>ΔpΔx = h/2*pi </span>

<span>Δp = the uncertainty in momentum </span>
<span>Δx = the uncertainty in position </span>
<span>h = 6.626e-34 J s (plank's constant) </span>

<span>Hint: </span>

<span>to calculate Δp use the fact that the uncertainty in the momentum is 1% (0.01) so that </span>

<span>Δp = mv*(0.01) </span>

<span>m = mass of electron </span>
<span>v = velocity of electron </span>

<span>Solve for Δx </span>

<span>Δx = h/(2*pi*Δp) </span>

<span>And that is the uncertainty in position. </span>
6 0
4 years ago
Explain why lithium is a strong reducing agent, whereas fluorine is a strong oxidizing agent.
Tom [10]
Lithium is a good reducing agent because it is electropositive [it rapidly gains electrons]
fluorine is  good oxidizing agent electronegative [it loses electrons fastly]
3 0
3 years ago
A. Electrons have a charge of_____
Dmitry [639]
Electrons: negative
Protons: positive
Neutrons: nuetral
5 0
3 years ago
Read 2 more answers
A chemist measures the enthalpy change ?H during the following reaction: Fe (s) + 2HCl (g) ? FeCl2 (s) + H2 (g) =?H?157.kJ Use t
erik [133]

Correct Question:

A chemist measures the enthalpy change ΔH during the following reaction: Fe(s) + 2HCl(g)-->FeCl2(s) + H2 ΔH=-157.0 kJ. Use this information to complete the table below. Round each of your answers to the nearest kJ/mol

Answer:

-314 kJ

+628 kJ

+157 kJ

Explanation:

The enthalpy change of a reaction measures the amount of heat that is lost or gained by it. If ΔH >0 the heat is gained, and the reaction is called endothermic, if ΔH<0, the heat is lost, and the reaction is called exothermic.

If the reaction is inverted, the value of ΔH is inverted too (the opposite endothermic reaction is exothermic), and if the reaction is multiplied by a constant, ΔH will be multiplied by it too.

1) 2Fe(s) + 4HCl --> 2FeCl2(s) + 2H2(g)

This reaction is the product of the given reaction by 2, so

ΔH = 2*(-157) = -314 kJ

2) 4FeCl2(s) + 4H2(g) --> 4Fe(s) + 8HCl(g)

This reaction is the inverted reaction given multiplied by 4, so

ΔH = 4*(157) = +628 kJ

3) FeCl2(s) + H2(g) --> Fe(s) + 2HCl

This reaction is the inverted reaction given, so

ΔH = +157 kJ

4 0
3 years ago
Other questions:
  • The R group or side chain of the amino acid leucine is non-polar. The R group of serine is polar. Where would you expect to find
    12·1 answer
  • Methane<br><br> state at 25 degrees Celsius​
    9·1 answer
  • Thermal energy is what we call energy that come from ___ of matter
    6·2 answers
  • What is the percent yield if 107.50 g NH3 reacts with excess O2 according to the
    15·1 answer
  • Please help! I will give brainilist........
    13·1 answer
  • Other than water, what substance is formed when an acid and a base are combined in a water solution?
    12·1 answer
  • What is the speed of a wave with a frequency of 2 Hz and a wavelength of 87m (subject is science) pls answer fast
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • chegg The value for the equilibrium constant for the following chemical reaction, the auto-ionization of water, is 1.0x10-14 at
    8·1 answer
  • It takes 11. 2 kj of energy to raise the temperature of 145 g of benzene from 23. 0°c to 68. 0°c. what is the specific heat of b
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!