1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sindrei [870]
2 years ago
14

Consider the skeleton.

Biology
1 answer:
Katen [24]2 years ago
3 0
The answer is B. Axial skeleton
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
A dominant mutation in Drosophila called Delta causes changes in wing morphology in Delta/+ heterozygots. Homozygosity for this
strojnjashka [21]
I don't know I just want
6 0
3 years ago
Why is it beneficial for the sex cells made at the end of meiosis to be DIFFERENT from each other?
Anestetic [448]

Answer:

if sex cells were identical, there won't be genetics variations and we will just all be identical to our parents. genetic variation allows us to better adapt and survive

8 0
3 years ago
What are the three types of axonometric projection?
Shkiper50 [21]
Three types of axonometric projection<span> are </span>isometric projection,  trimetric projection. and dimetric projection.
6 0
3 years ago
The binding of the neurotransmitter to receptors on the motor end plate causes which of the following to occur?
dmitriy555 [2]

The correct answer is: D) Binding of the neurotransmitter causes chemically gated sodium channels to open in the motor end plate (junctional folds of the sarcolemma) and sodium enters the cell.

The motor neuron cell is connected to muscle cell via synaptic cleft, where neurotransmitter is released. The muscle side of this synapse is called motor end plate. Released neurotransmitter is acetylcholine and it binds to its receptor (ACh receptor) on the motor end plate. As it binds, ion channels open, and Na+ gets into the muscle cell. This event reduces the voltage difference between the inside and outside of the cell and causes  depolarization which creates a wave through the entire muscle cell (its membrane-sarcolema). As a consequence, Ca2+ is released from the sarcoplasmic reticulum which will cause the contraction of the muscle cell.

4 0
3 years ago
Other questions:
  • Are corpse flowers vascular or non vascular?
    5·1 answer
  • Fill in the missing levels of organization in living things from smallest to largest: cell, __________, organ, _______________,
    9·2 answers
  • After the eighth week of pregnancy, the developing offspring is known as
    14·1 answer
  • A client has a history of sickle cell anemia with several sickle cell crises over the past 10 years. What blood component result
    6·1 answer
  • 1. Describe the movements of transverse adduction and flexion for the pectoralis major and biceps brachii muscles.
    15·1 answer
  • Which medicines are able to heal people from an
    12·2 answers
  • Dolphins (which are mammals) and sharks (which are fish) have stiff dorsal fins projecting from their backs that help them maneu
    6·1 answer
  • Which statement about technology is true? Technology improves a scientist’s ability to make observations. Technology does not ha
    14·2 answers
  • Refer to this portion of a dichotomous key to answer the question.1. (a) Has a single dorsal fin ® 5 (b) Has a double dorsal fin
    15·2 answers
  • Gregor Mendel experimented with patterns of inheritance in the 1800s. His work
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!