1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvasek [131]
2 years ago
6

Which of the rock samples below is most likely to be a metamorphic rock?

Biology
2 answers:
IgorC [24]2 years ago
5 0
Theres no picture in this question
Sphinxa [80]2 years ago
3 0

Answer:

D

Explanation:

You might be interested in
HELPPP PLZZZ asapppp plzzzz
andrew-mc [135]
D is the correct answer
3 0
3 years ago
What is the importantence of the carbon and nitretan cycles in the environment
Dmitrij [34]
The carbon lives in the plant or animal and when it dies, nitrogen sinks into the soil which is used as nutrients for plants.
7 0
2 years ago
Can anyone give a help with this please I have to submit it tomorrow!!
Usimov [2.4K]

Answer:

Q.1: I can't help you with this, sorry :(

Q.2: Seaweed is the producer because it takes energy from the water and sun in thermal reactions.

Q.3: Phytoplankton is the second-order consumer because they eat first-order consumers.

Q.4: Whelks and crabs because they eat limpets, which eat producers, and they also eat seaweed.

Q.5: Gulls are carnivores because they eat the crabs, and so are crabs because they eat mullets

Q.6: Limpets and lobster would become less populated, but not yet endangered. Gulls would starve and probably disappear from this ecosystem.

Q.7: Whelks' numbers would decrease because of the number of lobsters consuming them, but then lobsters would starve because of the decline in their food. Then this would repeat, shaking the whole ecosystem.

6 0
2 years ago
Read 2 more answers
An endospore may survive a drought because it is protected by a
dmitriy555 [2]

Answer:

b. thick wall.

Explanation:

Endospore is a structure formed by some bacteria, that help them survive unfavourable conditions (e.g. lack of nutrients). This survival strategy of some bacteria (usually Gram+ bacteria) help them stay dormant for a while, until stressful conditions stop. A thick wall composed of many layers (exosporium, spore coat, spore cortex, core wall) of the endospore is what provides resistance to different stressful chemical and physical factors such as UV radiation, temperature, chemical damage etc.

5 0
3 years ago
Who created the scientific method?
oee [108]
<span>Francis Bacon was the one who invented the scientific method!</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • A transcription factor that binds to a gene first and facilitates binding of other transcription factors is called a(n) ________
    14·1 answer
  • An ideal gas is held in a container of volume V at pressure p. The rms speed of a gas molecule under these conditions is v. If n
    11·1 answer
  • How do the effects of climate change differ from the effects of habitat alteration, invasive species, overharvesting and polluti
    15·2 answers
  • How is the size of a planet related to the thickness of its atmosphere? explain.
    5·2 answers
  • Which of the following characteristics differentiates an autotroph from a heterotroph?
    11·2 answers
  • Which of the following is an example of asexual reproduction?
    6·1 answer
  • What is an example of cell wall and also a non example
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 5. Which of the following statements describes processes that occur
    15·1 answer
  • in its second messenger role, cAMP activates enzymes called ____________, whose jobs is to regulate other enzymes by adding phos
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!