1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
14

(21 points) Please help, need quick

Biology
1 answer:
tiny-mole [99]3 years ago
5 0
Habitat: Coyotes are able to easily adapt to different habitats. They can be found living anywhere from the Sonoran Desert to large, populated cities.
Food: Coyotes will eat nearly anything. They hunt rabbits, rodents, frogs, fish, and even deer. they also eat insects, snakes, fruit, and grass.
Reproductive Process:  Reproduction<span> in the </span>coyote<span> is a very intricate </span>process<span>, as females are completely infertile for ten months out of the year, and males are sterile for eight. The </span>process<span> begins with several males vying for the attention of a single female.</span> In spring, females den and give birth to litters of three to twelve pups. Both parents feed and protect their young and their territory.
Human and Environmental Challenges: Coyotes face many challenges. They are often hunted by other larger animals. Humans also hunt them when they are interfering with their crops or livestock.
Migration pattern: <span>According to a study, coyotes migrated eastward via two main route: one that went through the northern United States, and one that went through the south. Oddly enough, the Northern and Southern coyotes seemed to meet midway</span>
You might be interested in
Use the format to show the Punnett square
Soloha48 [4]

Answer:

The genotype of the parents are not given. Let's try to answer this question generally. Let's assume the genotype of both parents to be Bb as genotype is not given.

Explanation:

       B        b

B    BB      Bb

b     Bb      bb

There is a 25% chance that the offspring will have BB genotype.

There is a 50% chance that the offspring will have Bb genotype.

There is a 25% chance that the offspring will have bb genotype.

There is a 75% chance that the offspring will have a dominant trait.

There is a 25% chance that the offspring will have recessive trait.

Phenotypic ratio will be 3:1

8 0
2 years ago
The most common type of poisoning by gases is ______ poisoning.
Arte-miy333 [17]
Carbon monoxide is the most common type of poisoning by gases
7 0
3 years ago
Read 2 more answers
Glycerol and other organic compounds with an -ol ending is called
AleksAgata [21]
Alcohol like ethanol
6 0
3 years ago
I need the answer someone help
fenix001 [56]

Answer:

<em>The answer is </em><em>A</em>

Explanation:

<em>Because each part of Earth does have its natural resources.</em>

<em>Not all the places have the exact same resources to make medicine for example they have to adapt to their surroundings and make the most out of it, or if they have the option they could import some ingredients for the medicine.</em>

<em>So basically The answer is option A each place has different kinds of resources and advantages.</em>

<u><em>Hope I Helped</em></u>

6 0
3 years ago
An allele is an alternate form of the same gene.<br> A. <br> TRUE<br> B. <br> FALSE
bazaltina [42]
I believe its true

hope this helped
3 0
2 years ago
Other questions:
  • Will give Branliest!
    9·1 answer
  • RNA primer constructed during DNA replication needs to be replaced because RNA differs from DNA. It contains_______ instead of__
    13·2 answers
  • Which physical characteristic of the neonate is typically present in the neonate of a primigravid mother?
    15·1 answer
  • How do cells in a multicellular organism become specialized?
    13·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which is an example of when Hector's somatic sensory system is in control?
    14·1 answer
  • Question 8
    14·1 answer
  • Which of the following is not a natural cause of extinction?
    15·1 answer
  • The cell knows which amino acids are to be attached to the ribosome during translation by reading the ______________ found on th
    9·1 answer
  • Name 2 ways that the Theory of evolution is currently being used to improve the quality of human life
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!