The Sun's outer gases extend far beyond the photosphere (Figure 6). Because they are transparent to most visible radiation and emit only a small amount of light, these outer layers are difficult to observe. The region of the Sun's atmosphere that lies immediately above the photosphere is called the chromosphere.
Answer:
I.
4) The deoxygenated blood then travels through the veins and enters the right side of the heart.
1) The blood leaves the heart through the aorta.
2) The blood travels throughout the body via the arteries to the capillaries.
3) In the capillaries, the exchange of nutrients and gases occurs. Oxygen is absorbed by the cells while carbon dioxide is released into the blood.
II.
2) Exchange of gases happens as oxygen is received by the blood and carbon dioxide is released.
1) The deoxygenated blood flows from the right side of the heart to go to the lungs.
3) The oxygenated blood then returns to the left side of the heart.
Explanation:
Answer:
DNA is a double stranded molecule that belongs to a group of larger molecules (macromolecules) called NUCLEIC ACIDS.
Nucleic acids are formed by joining together many smaller molecules called NUCLEOTIDES.
Nucleotides consist of:
- Pentose sugar (pentagon)
- Phosphate group (circle)
- Nitrogenous (rectangle)
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer: Im pretty sure it’s folding.
Might not Be right.Sorry if it isn’t.