1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
10

Which of these is an autotroph?

Biology
2 answers:
Sliva [168]3 years ago
4 0

There’s no list or options but, an autotroph is something that makes its own food, like plants. :) AUTO means SELF!

Lilit [14]3 years ago
4 0

i don't know what the options are but here's some info about autotrophs:

- autotrophs are plants or something that makes its own food

- they are a major food source for heterotrophs (consumers)

- they provide almost all energy for animals

hope this helps!!

You might be interested in
Which layer of the sun is shown extending into space in the picture above?
Westkost [7]

The Sun's outer gases extend far beyond the photosphere (Figure 6). Because they are transparent to most visible radiation and emit only a small amount of light, these outer layers are difficult to observe. The region of the Sun's atmosphere that lies immediately above the photosphere is called the chromosphere.

3 0
3 years ago
Read 2 more answers
LET'S CHECK
Daniel [21]

Answer:

I.

4) The deoxygenated blood then travels through the veins and enters the right side of the heart.

1) The blood leaves the heart through the aorta.

2) The blood travels throughout the body via the arteries to the capillaries.

3) In the capillaries, the exchange of nutrients and gases occurs. Oxygen is absorbed by the cells while carbon dioxide is released into the blood.

II.

2) Exchange of gases happens as oxygen is received by the blood and carbon dioxide is released.

1) The deoxygenated blood flows from the right side of the heart to go to the lungs.

3) The oxygenated blood then returns to the left side of the heart.

Explanation:

4 0
2 years ago
Pls help! It’s Due today!!
Karolina [17]
Answer:

DNA is a double stranded molecule that belongs to a group of larger molecules (macromolecules) called NUCLEIC ACIDS.

Nucleic acids are formed by joining together many smaller molecules called NUCLEOTIDES.

Nucleotides consist of:

- Pentose sugar (pentagon)
- Phosphate group (circle)
- Nitrogenous (rectangle)
8 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
PLZzz help brainless
xeze [42]

Answer: Im pretty sure it’s folding.

Might not Be right.Sorry if it isn’t.

5 0
2 years ago
Other questions:
  • BRAINLIESTTT ASAP!!
    9·1 answer
  • How and why the plagioclase feldspar in basaltic rocks differs from that in grantic rocks
    7·1 answer
  • When assessing for fluid collection in the lungs during auscultation of lung sounds, you should:?
    7·1 answer
  • Tell whether the statement is TRUE or FALSE. Comic relief was rarely used in Shakespeare, and only in his comedies.
    7·1 answer
  • Describe how gene flow can increase genetic variation within two neighboring populations
    13·1 answer
  • Which structure is used by an amoeba to move? I NEED ANSWER ASAP
    7·1 answer
  • What would happen to the other organisms if all the crows in this ecosystem were to die due to an illness?
    14·1 answer
  • Arrange the processes to show the order in which sedimentary rocks are formed. weathering lithification erosion and transportati
    6·1 answer
  • the mississippi river carries tons of tiny rock fragments called sediments into the gulf of mexico. what do you think will happe
    8·1 answer
  • List 3 <br>danger of lack of TAP?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!