1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
10

Which of these is an autotroph?

Biology
2 answers:
Sliva [168]3 years ago
4 0

There’s no list or options but, an autotroph is something that makes its own food, like plants. :) AUTO means SELF!

Lilit [14]3 years ago
4 0

i don't know what the options are but here's some info about autotrophs:

- autotrophs are plants or something that makes its own food

- they are a major food source for heterotrophs (consumers)

- they provide almost all energy for animals

hope this helps!!

You might be interested in
Jamie has decided to breed rabbits. Her male rabbit is white, while her female rabbit is black. They produce a litter of black a
Lesechka [4]

The answer would be CODOMINANCE because codominance is when 2 genotypes show up at the same time on an object, where incomplete dominance is when 2 different genotypes combine and create a whole new phenotype

8 0
4 years ago
hich cell structure is the gatekeeper, controlling what goes in and out of the cell? A) c - nucleus Eliminate B) e - vacuole C)
andrezito [222]
<span>A) c - nucleus Eliminate</span>
8 0
4 years ago
Give the correct which changes the given organisms are seen in order of their lifespan:
TEA [102]

Answer:

banyan tree --- parrot--- crow--- parrot.

3 0
3 years ago
Which of these can be predicted with the help of science? meaning of life success in career severe weather conditions number of
Oxana [17]
"severe weather conditions" are the only things than can be reasonably well predicted with the help of science. Of course the accuracy of these predictions varies greatly. 
<span />
4 0
3 years ago
Read 2 more answers
What makes some collisions elastic and others inelastic?
quester [9]

Answer : The The correct option is, If there is energy lost in the collision to sound, heat, etc., the collision is inelastic.


Explanation :

  • Elastic collision : It is defined as in which there is no loss of kinetic energy in the collision.
  • Inelastic collision : It is defined as in which there is a loss of kinetic energy in the collision and this energy changed to another form of energy.

If the collision involves bouncing, it is inelastic because kinetic energy is not conserved.

If the collision involves sticking together, it is inelastic because kinetic energy is not conserved, it is changes to potential energy.

7 0
3 years ago
Read 2 more answers
Other questions:
  • The organ that produces the egg cell in the life cycle of the pine is called the____? A.Ovules B.Antheridia C.Archegonium
    7·2 answers
  • Which of the following is a property of the stem of a dicot plant?Select one of the options below as your answer:A. ground tissu
    6·1 answer
  • What molecules make-up the sides of a dna molecule
    5·1 answer
  • PLEASE HELP ME! I WILL REWARD BRAINLIEST IF TWO PEOPLE ANSWER!!!!!!!
    7·2 answers
  • Explain the need for ventilation systems in a multicellular organism
    13·1 answer
  • (08.01 MC)
    9·2 answers
  • The genetic code of a strand of dna is determined by a specific specific sequence of
    6·1 answer
  • Which of the following is true of genetic drift?
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Please help me. I needed it for tomorrow
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!