All categories

2 years ago

What implications need to be considered when creating environmental policies?

Biology

2 answers:

Viefleur [7K]2 years ago

5 0

Answer:

2 and 4

Explanation:

bixtya [17]2 years ago

5 0

Answer:

Explanation:

When dealing with environmental laws and other policies the policymakers need to make users how much will the cost be or need to take an estimate of the funds that are needed to make environmental policies.

Then it's essential to estimate the environment in which it's going to affect and take into account the effect of these policies it will have on other environments. Whether it will be beneficial for the others taking into account the human factors like immigration and emigration etc.

Environment laws have never been made without the due acceptance of the countries in treaty such as the UNEP is a program that aims for all the overall environmental protection and regulation of norms of planning.

You might be interested in

HEELLPP ASAPP PLEASEE!!<br><br> don’t answer if u don’t know

ikadub [295]

Answer:

Brown is the dominant gene and white is the recessive gene.

Explanation:

If brown were to be dominant then the mice would most likely all be brown unless the got both a white from mom and dad which is most likely due to brown being recessive the dad could be part white you just wouldn't see it. And since the mother is white all of the mice get a white gene from the mom and since the dad most likely has a white gene hidden inside of him only tow mice became fully white while the siblings were brown.

Hope this helps.

6 0

3 years ago

Examples of decapods are

Monica [59]

Answer:

Crabs, lobster, shrimp, etc.

Explanation:

6 0

2 years ago

Membrane proteins of hamster cells were marked with a blue dye and membrane proteins of human cells were marked with a green dye

Luden [163]

Fat membrane metabolic disorder facts hamster cells were marked with a blue dye and membrane proteins

8 0

3 years ago

What is Florida’s state freshwater fish don’t search guess

goblinko [34]

Answer:

largemouth bass

Explanation:

6 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago