1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
4 years ago
9

Find the distance from each vertex on the preimage triangle ABC to the center of rotation, P Enter the values in the table. Do t

he same for each vertex on the other images?
Mathematics
1 answer:
zmey [24]4 years ago
5 0

Answer:

Vertex Distance to P  Vertex Distance to P

A 2.24  G 2.24

B 5.00  H 5.00

C 4.47  I 4.47

D 2.24  J 2.24

E 5.00  K 5.00

F 4.47  L 4.47

Step-by-step explanation:

You might be interested in
How do I find the perimeter of a triangle with sides 3ft 8in., 2ft 10in., and 4 ft?
Dmitriy789 [7]
Formula for triangle perimeter is: a + b + c. In this scenario we have:

a = 3 feet 8 inches
b = 2 feet 10 inches
c = 4 feet

a + b + c =
= 3 ft + 8 in + 2 ft + 10 in + 4 ft =
= 9 ft + 18 in

We know that 1 foot is 12 inches, so we can simplify the result to this form:

10 ft + 6 in

or:

<u>10.5 feet</u>
4 0
3 years ago
A group of 18 people ordered soup and sandwiches for lunch each person in the group had either one soup or one sound the sound j
victus00 [196]
10 sandwiches and 8 soups were ordered.
5 0
4 years ago
Jessica had m beads. She used 18 of them to make a necklace for her mom. Then she used the rest to make k bracelets for her frie
Y_Kistochka [10]
The expression to represent this would be (m-18)/k.

We first subtract the 18 beads she used in her mother's bracelet from her beginning number, m.  We then divide our result by k, the number of bracelets she made for her friends.
3 0
4 years ago
Website
luda_lava [24]
905,600 visitors

I added each number up and divided them by 5 (the total number of websites) to get 905,600
8 0
3 years ago
Read 2 more answers
Brainliest gets 22 points
Oliga [24]

Answer:

please provide a chart next time a question is asked

Step-by-step explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • A package of colored paper contains 20 pieces of yellow paper. This represents 25% of the total pieces of colored paper in the p
    13·1 answer
  • They sold 64 adult tickets (x) and 132 kid tickets (y) and made $1040. An adult ticket is double the cost of a kid's ticket. How
    13·1 answer
  • 5 a Write down the two prime numbers that are factors of 28.
    14·1 answer
  • Find two fractions with the difference of 1/5 but with neither denominator equal to 5
    5·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is y if c≠d? Please help!
    6·1 answer
  • Margaret is saving money for her summer vacation. She calculates that her starting amount is 0.4% of the total amount she wants
    6·1 answer
  • 6x + 2 + 3x + 7 <br> is that the answer
    7·1 answer
  • Please help please please please please please someone helpppp please please please pleaseeeeeeeee
    13·1 answer
  • The radius of a circle can be approximated using the expression √(A/3). A circular kiddie swimming pool has an area about 28 squ
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!