1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
8

All cells perform various jobs or​

Biology
1 answer:
mafiozo [28]3 years ago
6 0

Answer: Yes, All cells have various jobs in the body.

Explanation:

You might be interested in
1. Describe some of the important observations that Darwin made, both while he was traveling on the expedition of The Beagle and
lions [1.4K]

In Galapagos Charles Darwin Discovered a large amount of birds and reptiles that had developed a sense of isolation from the main land.

Explanation:

8 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
An oxidation reaction
Katen [24]

Answer:

c is the answer............

4 0
3 years ago
Which of the following does NOT effect the rate of enzyme reaction?
chubhunter [2.5K]

From the options that factor that does not effect the rate of enzyme reaction is : ( D ) Amount of product.

Enzymes are substances found in organisms that catalyzes the rate of chemical reaction occurring in an organism. during the chemical reaction the enzyme remains intact and is not utilized during the process.  

Some of the process that may Inhibit the performance of an enzyme(s) includes ;

  • pH ,
  • The substrate concentration,
  • Temperature and
  • The concentration of the enzyme.  

The amount of the product does not affect the performance rate of the enzyme because enzymes functions in chemical reactions and not physical reactions

Hence we can conclude that the factor that does not effect the rate of enzyme reaction is the  Amount of product

Learn more : brainly.com/question/13981863

6 0
2 years ago
Would you expect sound waves to travel faster through a low density gas such as helium or a higher density such as carbon dioxid
Fed [463]
The answer is carbon dioxide
7 0
3 years ago
Read 2 more answers
Other questions:
  • What is not characteristic of primitive mammals?
    13·2 answers
  • Human sperm cells and egg cells are
    14·2 answers
  • When Mendel crossed true–breeding pea plants that have inflated pods (PP) with those that have constricted pods (pp), it was obs
    5·2 answers
  • An object is accelerating if there is a change in speed and/or
    14·2 answers
  • Biomes are large regions characterized by certain conditions, including a range of climate and ecological communities adapted to
    11·1 answer
  • Explain how Co2 is able to control fires?<br><img src="https://tex.z-dn.net/?f=co2" id="TexFormula1" title="co2" alt="co2" align
    12·1 answer
  • Of the following organisms, which is more likely to be very slow to respond to stimuli?
    10·2 answers
  • What are the differences between renewable resources, non renewable resources and sustainable option?​
    8·1 answer
  • Why doesn't a negative stain colorize the cells in the smear?
    11·1 answer
  • Enzymes catalyze many important chemical reactions in the human body. Name one of these chemical reactions.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!