1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RideAnS [48]
3 years ago
7

You are a pharmaceutical researcher trying to design a new drug for the treatment of cystic fibrosis. You are aware that an extr

acellular protein that is a chloride ion transporter is misfolded and never gets to the cell surface. You have a new undergraduate working with you. Explain which organelle is involved in this process and why the transporter protein is nonfunctional.
Biology
1 answer:
iragen [17]3 years ago
4 0

Answer:

Endoplasmic reticulum is the defective organelle in most CF.

Explanation:

This is because of  mutation(deletion) in the proteins of these organelle. The CFTR  protein -a transmembrane regulator get stucked inside the E.R, thus  the  CFTR chloride protein channel is blocked. Therefore the outflow of Cl and water  out of the cell  is obstructed.

Consequently, the mucus from blocked fluid flow, clogs the lungs, the fallopian tube, sweat duct, and other places.

You might be interested in
Ground pork should be cooked to an internal temperature of _______________ to destroy the parasite Trichinella spiralis.
patriot [66]

Answer:

160°

Explanation:

Ground pork should be cooked to an internal temperature of 160° to destroy the parasite Trichinella spiralis. 160°F (71°C) 89. All of the following are good instructions for preventing foodborne illness except when shopping, select meat, poultry, or fish first.

3 0
2 years ago
Aquatic ecosystems are governed by factors such as amount of oxygen, amount of light, and water movement.
34kurt
False

<span>Marine ecosystems like lakes and oceans have aphotic zones. Aphotic zones refer to the zones in the water where there is little or no sunlight. It is found in bodies of water were depths only receive less than 1% of sunlight penetrations. Bioluminescence is essentially the only light found in this zone and most food comes from dead organisms that sink at the bottom of lakes or oceans. </span>
8 0
2 years ago
The ____________ functions as a gateway through which chemicals and small particles, such as ____________ enter or leave the cel
Vilka [71]

Answer: cell membrane

such as water, micro-organism

physical process

simple diffusion, osmosis and filtration

such as potasssium permaganate in water,urea a liver waste diffuses from the body and the kidney help in filtering it out

physiological processs

active transport, phagocytosis and pinocytosis

such as soduim-potassium pump, exocytosis

Explanation:  transportation in and out of cell is done in different ways listed above but a barrier to this movement is the cell membrane which is an outer covering of the cell. it protect the cell and only some materials can penetrate the cell membrane e.g micro-organism, water e.t.c. the various physical and physiological processes are the various ways substance  cna be liquid, solid or gas are transported within or outside the  cell e.g food

6 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Punnett squares are used to show possible combinations of alleles or to predict the probability of a trait occurring in offsprin
IgorC [24]
50% of the offspring would have a feather color that results from incomplete dominance.
8 0
3 years ago
Read 2 more answers
Other questions:
  • How effective was Jonas Salk’s initial testing of the polio vaccine?
    8·1 answer
  • The complete set of genetic information an organism carries in its dna is its
    15·2 answers
  • What is the difference between malthusian growth and logistic growth?
    7·1 answer
  • Which disruption in the water cycle would most likely affect photosynthesis?
    13·2 answers
  • How does current theory explain the origin of a nucleus in eukaryotic cells? Please choose the correct answer from the following
    11·1 answer
  • Tess has second- and third-degree burns on her arms and face. explain why the burns that tess suffered make her very susceptible
    9·1 answer
  • Explain how the environment and economy has impacted because of coronavirus
    7·2 answers
  • At the end of the term, the professor locks the students in the classroom with plenty of food and water and leaves them there fo
    15·1 answer
  • In this example, a flower can either express the dominant trait (R), red petals, or the recessive trait (r), yellow petals. If t
    14·1 answer
  • Sample 1<br> sample 2<br> sample 3<br> sample 4
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!