1. TTGCATGCTAGCTACGTGTACGTACCGATGCG
2. GGGCCCATACGTACATGCATGCAGCATATAGC
3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
You should double check those to make sure I didn't make any mistakes. Hope this helps!
The orangutans (also spelled orang-utan, orangutang, or orang-utang) are three extant species of great apes native to Indonesia and Malaysia.
...
Orangutan.
I hope that helps! Let me know if you have any questions.
Answer:
e. All of the above are considered species under at least one species concept.
Explanation:
All of the abovementioned conditions satisfy at least one condition of species definition. Further arguments are given below to support each statement,
a. A species is the <u>monophyletic group</u> of individuals who has a <u>common ancestor</u> which could be <u>distinguished from the closest phylogenetic relative</u> based on <u>conserved genes</u> (16S in bacteria and 18S in eukaryotes). In the statement above, beetles satisfy this condition.
b. A species is the group of individuals that are capable of <u>exchanging genes or can interbreed</u>. In the above statement, birds who are interbreeding with each other must be a single species.
c. A metapopulation is generically defined as the group of populations who are <u>separated by space</u> but are the <u>same species according to phylogenetic analysis</u>. Thus, the metapopulation of salamanders who are linked by gene flow (gene migration) should be treated as one species.
d. The word "<u>lineage</u>" already conveys the message that these bacteria belong share <u>sample place in the phylogenetic tree</u> and they are capable to adapt the same environmental niche. Therefore, they should be considered as one species. This can be easily tested via 16S rRNA sequencing.
Answer:
H20 is not a product of combustion
Answer: 1, 3, 5
new nuclei begin to form
chromatids arrive at opposite ends of the cell
cytoplasm divides and two daughter cells are formed