Endocyrosis and exocytosis are types of bulk transport
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Bees play a significant role in the field of agriculture. They can adapt to the process of pollination. Pollination is usually defined as the process of transportation of pollen grains from the male anther of a flower to the female stigma. The bees pollinate the crops and increases their productivity and yield capacity. About 35% of the food that we eat, are dependent on this pollination act that is carried out by the bees, involving either directly or indirectly.
Over the last few decades, the population of the bee has been decreasing, and it is directly affecting the global human population. It is because less amount of food is produced compared to the rate of demand, resulting in a shortage of food items.
