1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
3 years ago
12

How can we stop the spread of a virus?

Biology
2 answers:
Svetlanka [38]3 years ago
8 0
By staying home washing your hands and were a mask and gloves when out of the house also bring hand sanitizers has to be 70% alcohol or up for it to be affective.
Morgarella [4.7K]3 years ago
5 0

Answer:

How we can stop the virus from spreading is we can follow the goverment rules.wearing a mask,6 feet,and not partying.

Explanation:

You might be interested in
Which is formed when a chromium ion with a 3 charge combines with an oxygen ion with a 2- charge.?
wel
Cr2O3...................
3 0
3 years ago
In North American forest, two species of birds, nuthatches and brown creepers, forage on the same trees for insects. Brown creep
Yuri [45]

Answer:

The correct answer is - reducing competition between the birds for resources.

Explanation:

In this ecosystem, the two species of birds brown creepers and nuthatches share habitat in the same tree for their food resources are insects. Brown creepers feed on resources on the bottom of the tree whereas nuthatches feed on the top of the tree.

By this, they avoid competition between these two birds for the same food resources in the same tree. The competition would be more if both have depended on the insects all over the tree.

4 0
3 years ago
Darwin suggested looking at a species’ close relatives to learn what its ancestors may have been like. how does his suggestion a
m_a_m_a [10]
Phylogenetic bracketing is a technique for surmising utilized as a part of organic sciences. It is to deduce the probability of obscure attributes in life forms in view of their position in a phylogenetic tree. One of the primary utilizations of phylogenetic sectioning is on wiped out creatures, known from fossils.
3 0
3 years ago
Read 2 more answers
Which of the following is not considered a sustainable development strategy for management of earths resources?A. Contour plowin
lilavasa [31]

Selective harvesting of trees

5 0
4 years ago
Every time you and your friend study for an exam while listening to classical music, both of you do well on the exam. What testa
777dan777 [17]

Answer:

Development of testable hypothesis from observation

                                     According to one theory “listening to Mozart music induce short improvement in certain kinds of cognitive task”.  Study have shown a proposed link in improving the reasoning and visualization of students during examination in the presence of classical music. It means there is relationship between classical music and man hormonal system. Therefore, listening to classical music raise dopamine and treating depression level. It leads to better performance in examination.  

                                 Silveraja et al. (2015) studied the effect of classical music on examination performance while students solving their papers in examination hall. He concluded that in the presence of music the performance was better.



3 0
4 years ago
Other questions:
  • you are a molecule of phosphorus. choose a starting point in the phosphorus cycle and describe the process you would go through
    9·2 answers
  • A six-year old spent the day eating sweets. he ate cookies for breakfast, ice cream for lunch and candy for supper. how did his
    15·1 answer
  • Look at the image. Recall the structures and parts of a flower. Use the drop-down menus to answer each question.
    14·2 answers
  • ​ Tao wakes up his roommate Don so that he doesn’t miss his morning classes again. Don tells Tao, "I wish you hadn’t woken me up
    7·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Will mark brainliest if answer is correct!
    11·2 answers
  • A 1-day-old infant in the shadow general hospital nursery has a yellow tint to the skin. what is this called?
    13·1 answer
  • Which of the following processes causes
    13·2 answers
  • 1. What academic subset of oceanography studies seafloor features and the processes that form them?
    14·2 answers
  • According to the model below, how long ago did the common ancestor of all the organisms on the
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!