Base Sequence of Complementary DNA Strands: One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3

Question

3 years ago

11

Base Sequence of Complementary DNA Strands: One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3

’). a) Write the base sequence of the complementary strand. b) What special type of sequence is contained in this DNA segment? c) Does the double-stranded DNA have the potential to form any alternative structures?

Biology

1 answer:

Lelu [443] · Answer 1 · 2022-07-24T03:57:32+03:00

Answer:

a) : The complementary strand is

(5ʼ)GCGCAATATTTTGAGAAATATTGCGC(3ʼ)

b) This sequence has a palindrome, an inverted repeat with twofold symmetry:

(5ʼ)GCGCAATATTTCTCAAAATATTGCGC(3ʼ)

(3ʼ)CGCGTTATAAAGAGTTTTATAACGCG(5ʼ)

c)Because this sequence is self-complementary, the individual strands have the potential to form hairpin structures. The two strands together may also form a cruciform.

Explanation:

One strand of a double-helical DNA has the sequence (5’)GCGCAATATTTCTCAAAATATTGCGC(3’)

a) : The complementary strand is

(5ʼ)GCGCAATATTTTGAGAAATATTGCGC(3ʼ) the sequence of a single strand is always written in the 5ʼ→3ʼ direction.

b) This sequence has a palindrome, an inverted repeat with twofold symmetry:

(5ʼ)GCGCAATATTTCTCAAAATATTGCGC(3ʼ)

(3ʼ)CGCGTTATAAAGAGTTTTATAACGCG(5ʼ)

c)Because this sequence is self-complementary, the individual strands have the potential to form hairpin structures. The two strands together may also form a cruciform.