1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
3 years ago
6

01:20:01

Biology
2 answers:
harkovskaia [24]3 years ago
7 0

Answer:

The correct Answer is B Madagascar

Explanation:

Just took the test

Free_Kalibri [48]3 years ago
4 0
Helllo u seem very smart
You might be interested in
1. Which of the following refers to the process of an environment constantly changing?"
Bumek [7]

Answer:

I believe it's ecological succession.

Hope that helps!

8 0
3 years ago
Read 2 more answers
what is the meaning of phosphoryl transfer potential and what does it mean to have a high or low phosphoryl transfer potential?
makvit [3.9K]

Phosphoryl-transfer potential is the ability of an organic molecule to transfer its terminal phosphoryl group to water which is an acceptor molecule. It is the “standard free energy of hydrolysis”.

Explanation:

This potential plays a key role during cellular energy transformation by energy coupling during ATP hydrolysis.  

A compound with a high phosphoryl-transfer potential has the increased ability to couple the carbon oxidation with ATP synthesis and can accelerate cellular energy transformation.  

A compound with a high phosphoryl-transfer potential can readily donate its terminal phosphate group; whereas, a compound with a low has a lesser ability to donate its phosphate group.

ATP molecules have a high phosphoryl transfer potential due to its structure, resonance stabilization, high entropy, electrostatic repulsion and stabilization by hydration. Compounds like creatine phosphate, phosphoenolpyruvate also have high phosphoryl-transfer potential.

8 0
3 years ago
Refer to the erg to find the potential hazards to health for un1825
Nat2105 [25]
<span>UN1825 refers to Sodium monoxide.It is a white granular material. It reacts with water to give sodium hydroxide with the evolution of heat. It is corrosive to metals and tissue. The oxides of sodium and potassium react with water vigorously and with enough evolution of heat to cause boiling and spattering of hot caustic solution.Reaction with water may generate much heat that will increase the concentration of fumes in the air. Fire will produce irritating, corrosive and/or toxic gases. Runoff from fire control or dilution water may be corrosive and/or toxic and cause pollution.</span>
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
A species of alligator remains unchanged for 100 million years, then suddenly an ice age forces them to adapt to colder temperat
Vinil7 [7]

Answer:

its c

Explanation:

i searched it up online LOL, your welcome

5 0
3 years ago
Other questions:
  • According to frank-starling's law of the heart, the cardiac output is directly related to the:
    9·1 answer
  • Putting an ice pack on an injury
    5·1 answer
  • The simple question of whether or not viruses are alive, has defied a simple answer because it raises the fundamental issue: Wha
    5·2 answers
  • What are homologous structures in different species evidence of?
    12·1 answer
  • If the DNA of a representative species from each of the major kingdoms was examined, the sequences coding for which of following
    10·1 answer
  • What can cause the regional or local extinction of species, or shifts to
    8·1 answer
  • Reflex responses are controlled in your _____
    6·1 answer
  • The table shows the percentage of different colors of rats in a population that survive to reproduce.
    8·2 answers
  • Chromosomes are made up of (a) DNA (b) Protein (c) DNA and protein (d) RNA answer fast plzzz
    11·1 answer
  • Neurotransmitters can affect postsynaptic cells by I) initiating signal transduction pathways in the cells II) causing molecular
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!