1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
3 years ago
10

Name the subunits that make up each of the macromolecules

Biology
1 answer:
Kazeer [188]3 years ago
7 0
Subunits are called nucleotides
You might be interested in
In 3–5 sentences, compare and contrast the flow of matter and energy in each
trapecia [35]

Answer:There is a fundamental difference in the way energy and matter flows through an ecosystem.Matter flows through the ecosystem in the form of the non-living nutrients essential to living organisms. When a living organism dies, nutrients are released back into the soil. These nutrients then are absorbed by plants, which are eaten by the herbivores. Matter, once again, is passed on. The herbivore is eaten by a carnivore (and matter is yet again transferred therein). Ultimately, when the carnivore dies, matter is returned back to the soil by the decomposers and the cycle repeats. So you see, matter is recycled in the ecosystem.Unlike matter, energy is not recycled through the system. A part of the energy is lost at each stage.

Explanation:

5 0
3 years ago
A researcher has developed two stains for use with seed plants. One stains sporophyte tissue blue; the other stains gametophyte
sukhopar [10]

Answer:

A) The pollen grains will be pure red.

Explanation:

Plants have alternation of generations, this means that there are two different stages in their life-cycle: a sexual haploid (n) phase and an asexual diploid phase (2n). These phases occur in different individuals, so there is an haploid plant called gametophyte that carries gametes and after fecundation, it will rise a diploid sporophyte (asexual).  

In seed plants, the sporophyte is the plant that we normally see, and the gametophyte is reduced into an organ of the sporophyte. The male gametophyte is the pollen that is produced in the sporangium in anthers (parts of sporophyte).  When a pollen grain fecundes a female gametophyte (egg), it will produce a diploid embryo or new sporophyte.

Therefore, if the researcher exposes pollen to both stains, these grain will stain red, because red stain identifies gametophyte tissue.

3 0
3 years ago
Evidence of plate movement can be seen at
deff fn [24]

Answer:

plate boundaries

Explanation:

i just think i remember it from 6th grade Imao, its been a couple years though

8 0
3 years ago
According to ____________________ theorists, even the mate selection process is shaped by a calculation of exchange.
Naddika [18.5K]
Rational choice theorists-- true
4 0
3 years ago
What is the meaning of monsoon​
prohojiy [21]

Explanation:

a seasonal prevailing wind in the region of South and Southeast Asia, blowing from the southwest between May and September and bringing rain (the wet monsoon ), or from the northeast between October and April (the dry monsoon ).

the rainy season accompanying the wet monsoon.

7 0
3 years ago
Other questions:
  • What are three negative effects of diverting or stopping the flow of river water?
    9·2 answers
  • Which is an example of biodiversity contributing to the sustainability of an ecosystem?
    5·2 answers
  • A nonnative squirrel is introduced into a forest. Which would most likely prevent this squirrel from becoming an invasive specie
    12·2 answers
  • What happens to animals that are deprived of oxygen
    10·2 answers
  • PLEASE HELP WILL MARK BRAINLIEST <br> Dont answer if you dont know the answer
    14·1 answer
  • What cell part supports the structure of the system plant cell
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What can occur nitrogenous bases do not pair correctly?
    14·1 answer
  • How could you use a system of location similar to north/south and east/west to describe location on a patient's body? Why is thi
    8·1 answer
  • Bioswales A) Traveling with more than one person in a single vehicle
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!