Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
<span>Excess nitrogen is brought in the pond from the fertilizer, which are ladden in nitrogen and phosphorous, and rain water or running water takes that nitrogen to the water bodies.Bacteria must have come from the sewage disposal in the pond. Sewage is rich in organic material and allows proliferation of bacteria, which is taken to the pond when the sewage is disposed in the pond.</span><span />
Answer:
The key to the adaptation of living beings on the planet is the adaptation to abiotic factors such as temperature, light, salinity, humidity; and to biotic factors, which are represented by the action of the other organisms.
Explanation:
Lava that hardens on the surface is called an extrusion. The rock layers below an extrusion are always older than the extrusion. ... There, the magma cools and hardens into a mass of igneous rock called an intrusion. An intrusion is always younger than the rock layers around and beneath it.
