1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
3 years ago
15

How do most scientists think humans evolved?

Biology
2 answers:
galben [10]3 years ago
6 0

Answer: A

 

Explanation: I have read many books about how humans evolved and most said ''Humans evolved from gorillas and other primates.''

lesantik [10]3 years ago
5 0

Answer:

what should i answer lets say D

You might be interested in
Tapeworms can reproduce by _____.<br> budding<br> fission<br> fragmentation
Tema [17]
Binary fission is a type of asexual reproduction or rather an asexual reproduction common in most prokaryotes.
This function happens when the organism divides itself producing another replica of its genetic material and now altogether as the organism itself. 

Examples:
Bacteria
<span>archaebacteria</span>
5 0
3 years ago
Read 2 more answers
Which of the following happens when cancer occurs?
Fittoniya [83]
Normal cells in the body follow an orderly path of growth, division, and death. Programmed cell death is called apoptosis, and when this process breaks down, cancer begins to form.
6 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
What might stimulate the cephalic phase of gastric secretion?
kiruha [24]

Complete Question:

Which of the following might stimulate the cephalic phase of gastric secretion?

A. stomach distention

B. the production of saliva

C. the thought of food

D. the production and secretion of gastrin.

Answer:

C. the thought of food

Explanation:

Gastric secretion usually occurs in three different phases, namely;

- Cephalic

- Gastric

- Intestinal

The thought of food usually stimulate the cephalic phase of gastric secretion in organisms. The presence of lipids or low pH inhibits Gastric secretion during the intestinal phase.

7 0
3 years ago
If someone got sick with an intestinal infection from eating the yogurt, what type of antibiotics would you prescribe? Why?
garri49 [273]
Probiotics 

and why is down below
Probiotics:   <span> Probiotics are live microorganisms that may be able to help prevent and treat some illnesses. Promoting a healthy digestive tract and a healthy immune system are their most widely studied benefits at this time. These are also commonly known as friendly, good, or healthy bacteria.

That is why i would prescribe it
</span> 
5 0
3 years ago
Other questions:
  • What is the difference between parasite and a saprotroph?
    9·1 answer
  • When a organism dies, the substances in its body are what?
    9·1 answer
  • Is 28.5 qualitative or quantitative data?
    8·2 answers
  • According to endosymbiotic theory, mitochondria and chloroplasts contain a limited amount of genetic material and divide by_____
    8·1 answer
  • Frozen water (ice) has less density than liquid water.
    7·2 answers
  • Explain how primate hand features increase fitness and give one example. When writing about your example name the hand feature t
    13·1 answer
  • If linh removes bulb 3, which bulbs will remain lit
    11·1 answer
  • Plz help me with 2021 March Mammal Madness
    13·2 answers
  • True or false: Active transport is required to more particles from an area of lower
    12·1 answer
  • A heterozygous white rabbit is crossed with a black rabbit. What is the probability of getting black rabbit offspring?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!