Binary fission is a type of asexual reproduction or rather an asexual reproduction common in most prokaryotes.
This function happens when the organism divides itself producing another replica of its genetic material and now altogether as the organism itself.
Examples:
Bacteria
<span>archaebacteria</span>
Normal cells in the body follow an orderly path of growth, division, and death. Programmed cell death is called apoptosis, and when this process breaks down, cancer begins to form.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Complete Question:
Which of the following might stimulate the cephalic phase of gastric secretion?
A. stomach distention
B. the production of saliva
C. the thought of food
D. the production and secretion of gastrin.
Answer:
C. the thought of food
Explanation:
Gastric secretion usually occurs in three different phases, namely;
- Cephalic
- Gastric
- Intestinal
The thought of food usually stimulate the cephalic phase of gastric secretion in organisms. The presence of lipids or low pH inhibits Gastric secretion during the intestinal phase.
Probiotics
and why is down below
Probiotics: <span> Probiotics are live microorganisms that may
be able to help prevent and treat some illnesses. Promoting a healthy
digestive tract and a healthy immune system are their most widely
studied benefits at this time. These are also commonly known as
friendly, good, or healthy bacteria.
That is why i would prescribe it
</span>
