1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dennis_Churaev [7]
3 years ago
13

BEST ANSWER GETS BRAINLIEST!!!!! PLEASE HELP.

Biology
1 answer:
Gre4nikov [31]3 years ago
6 0
The green house effect is the only naturally occurring  problem.
 <span>The greenhouse effect is an increase in the average temperature of the Earth.  It happens because certain gases absorb infrared heat that would normally be radiated into space.  Infrared light is what you feel as heat from heat lamps used in restaurants to keep french fries hot.  It also causes the heat you feel from ordinary light bulbs.  Since carbon dioxide absorbs this heat, the more carbon dioxide there is in the atmosphere, the warmer the air will be.  If the air gets too hot, the balance of life will be disrupted.  Species of plants and animals will die.  The food chain could be upset.  This would cause many serious problems worldwide.</span>
You might be interested in
Explain why facilitated diffusion may need to occur and in what direction the particles diffuse in. Identify the molecules that
Goryan [66]

Answer:

Sometimes molecules cannot move through the cell membrane on their own. These molecules need special transport proteins to help them move across the membrane. Facilitated diffusion is the diffusion of substances with the help of transport proteins in the plasma membrane. These special proteins are called channel proteins or carrier proteins, and they are attached to the cell membrane. In fact, they go through the cell membrane, from the inside of the cell to the outside. Facilitated diffusion is used for molecules that cannot diffuse rapidly through cell membranes on their own, even when the molecules are moving from high to low concentration areas. An example is the sugar plants and animals use for energy, called glucose. Even though facilitated diffusion involves transport proteins, it is still passive transport because the solute is moving down the concentration gradient so it does not require the use of cellular energy.

6 0
2 years ago
One purpose of sports drinks is to replace fluid and electrolytes that are lost through sweating.
daser333 [38]
 the answer to the question is a. true
8 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Why are methane hydrates so difficult to extract from the seafloor?
AlexFokin [52]

The warmer the water, the larger the water depths must be to form the hydrate. Deep inside he sea floor, however, the temperature is too high for the formation of methane hydrates because of the Earth's internal heat. Oxidation Many bacteria use methane to provide energy for their metabolism.


-worldoceanreview.com

8 0
3 years ago
The _________________ is the hereditary material of the cell made up of sequences of four nucleotides arranged in linear strands
mario62 [17]

Answer:

DNA

Explanation:

The answer is DNA. It belongs to a class of molecules called the nucleic acids, which are polynucleotides(long chains of nucleotides)

Hope this helped :)

6 0
2 years ago
Other questions:
  • Read the description of evolution by natural selection in this section and describe the role that the environment plays in the t
    15·1 answer
  • About 10 or 15 minutes after Jim starts his daily five-mile jog, he usually begins to perspire heavily. His body's tendency to m
    15·1 answer
  • Jenna found a mushroom growing at school. Which question can a dichotomous key help her answer?
    15·2 answers
  • Fill in the blanks of the following sentences. A chromosome contains one long __________ molecule. Each gene in this molecule gi
    11·2 answers
  • Which of the following includes only biotic factors?
    6·2 answers
  • What is the expected size of the plasmid plus the cut foreign dna?
    13·1 answer
  • Some studies have indicated that our eyes naturally travel from bottom left to top right, so putting the diagonal along that pat
    5·2 answers
  • 20. A specific enzyme is involved in a certain body reaction. What will most
    10·1 answer
  • What is represented by<br> region on the sound<br> wave
    14·1 answer
  • The enzymatic breakdown of large molecules into their basic building blocks is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!