I don't know if this helps or not but you would want to know the age of the rock (absolute dating) and from there you will be able to know the age of the fossil and what caused it to die.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Deconstructionism is not a component of balanced and restorative justice model.
Balanced and restorative justice is termed as the theoretical model and attempts to span tension between treatment and retribution. In this process victims takes an active role. Offenders take full responsibility for their actions.
Seize an opportunity to do right from wrong and redeem themselves before their community and before their eyes. Restorative justice focuses on helping offenders from future offences.
The Ottomans were the first empire to use firearms and gunpowder.
Answer:
7.5cm
Explanation:
Velocity vs Time Graph:
When the object is going along the plane with velocity v at a particular time interval t we can explain it's motion via the velocity vs time graph. If the velocity of the object is constant then velocity vs time graph will produce a horizontal straight line. If the amount of differentiation of velocity of the object is positive and constant then the graph shows the linear line whose slope is is the same as the ratio of the change in velocity to the time interval.
Velocity vs time graph:
Is shown in the attached image
A velocity-time graph helps us to estimate the distance traveled by using the area under the graph.
Height of the triangle is the velocity (v) = 0.75m/s
The base of the triangle is the time interval (t) = 0.2sec
Distance travelled = Area of triangle
Distance travelled
= 1/2(V) * t
= 1/2(0.75m/s) * 0.2s
= 0.0075m
=7.5cm
Thus, during one beat blood flows 7.5 cm
