1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UkoKoshka [18]
3 years ago
15

Which property describes a material 's ability to conduct heat?

Biology
1 answer:
AveGali [126]3 years ago
8 0

Thermal conductivity

You might be interested in
Which structure does not belong in a prokaryotic cell
katen-ka-za [31]
I believe the nuclear membrane
6 0
3 years ago
Unlike ionic bonds, covalent bonds involve the
lara [203]
C. sharing of electrons
7 0
3 years ago
Why is the cycling of nitrogen, water, and carbon so important for life?
dimulka [17.4K]

Because all living things are made of carbon in one way or another and we use nitrogen and water naturally.

3 0
3 years ago
Which of the following is a component of potting soil
slava [35]
The answer is B topsoil<span>. The potting soil</span>, is use for cultivating floors, grasses and vegetables in a handle or container. <span>The potting soil</span><span> available in trades is sterilized in order to avoid the spread of bad grasses and diseases transmitted by the plants.</span>
6 0
3 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Other questions:
  • Question 1 (1 point) Question 1 Unsaved
    9·1 answer
  • Place the following events from the Civil War in the correct order with the numbers in the drop down
    8·2 answers
  • How do scientists use weather variables to describe and predict weather
    9·1 answer
  • How many genes make up the human genome?
    10·1 answer
  • Era
    15·2 answers
  • Which best describes the reactions and products of photosynthesis?​
    11·1 answer
  • Which substance increases its volume when it becomes a solid?
    15·2 answers
  • Help me PLEASE! Choose one answer! First one to answer get Brainliest!
    11·2 answers
  • Which element of an original work can be changed in an adaptation? Theme. Story. Setting. Main idea.
    8·1 answer
  • TRUE/FALSE. establishing a family history of osteoarthritis, rheumatoid arthritis, or ankylosing spondylitis is important becaus
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!