1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
4 years ago
15

Which is one way that the movement of matter through an ecosystem is different from the transfer of energy ?

Biology
1 answer:
Crazy boy [7]4 years ago
3 0

<u>Answer:</u>

Movement of matter passes through the ecosystem in the form of cycle, web, chain etc., between the living and non-living things. The base is the energy derived from sun. They involve all living organisms, air, water, soil etc. Matter never gets wasted instead utilized.

Matter is recycled in the ecosystem but energy is not. Energy is transferred from one organism to another approximately by 10% where balance of 90% is lost in the form of energy. The higher the levels in the food chain more exhaustion of energy due to work.  

You might be interested in
When a trait is shown and at least one letter is upper case.
max2010maxim [7]

Answer:

maybe trait?

Explanation:

dunno lol

3 0
3 years ago
Read 2 more answers
The first organism in most natural food chains is
iragen [17]

Answer:

photosynthetic

Explanation:

make the brianests pleasssse

6 0
3 years ago
Read 2 more answers
What are some tips for handling a raccoon​
kondor19780726 [428]

Answer: If it comes closer, make yourself look larger and make lots of noise. If it still continues to come closer then spray (or throw) water at it. A raccoon that is too aggressive or too tame may be sick or injured.

8 0
3 years ago
The_______
Irina-Kira [14]

Answer:

Messianic secret

Explanation:

The Messianic secret is a theme in the Gospel of Mark that portrays the disciples and others as recognizing Jesus' identity as the Messiah. Jesus directed them not to tell anyone else.

Hope this helps!

pls mark brainliest :)

4 0
3 years ago
WILL MARK AS BRAINLIEST!!!
Igoryamba
It is plasma. \\D\\\
4 0
3 years ago
Other questions:
  • What is the difference between hyper and hypo?
    11·1 answer
  • One major problem with the human-induced stress on ecosystems is that: newly introduced species almost never thrive in unfamilia
    7·1 answer
  • Explain complementary base pairing. which are purines and pyrimidines and who bonds to whom? how many hydrogen bonds form betwee
    13·1 answer
  • Into which chamber of the heart do the superior vena cava is located?
    8·1 answer
  • What component of enzyme structure is responsible for enzyme specificity
    6·2 answers
  • 13. Why do cells need both tRNA and mRNA? (1 point)
    5·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Nucleus factory and worker
    13·1 answer
  • Which fitness test measures your cardiovascular system?
    9·1 answer
  • Make a table summarising the main components of tobacco smoke and their effects on the human body.​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!