1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
3 years ago
8

what sort of succession follows when a farmland is abandoned and allowed to grow without human inference (primary OR secondary)?

explain your answer.

Biology
2 answers:
Elina [12.6K]3 years ago
7 0
Secondary succession because the pioneers e.g ant have been living there and even grass are growing so is secondary succession.
Assoli18 [71]3 years ago
6 0

Answer:

Secondary succession because it is the series of community changes which take place on a previously colonized, but disturbed or damaged habitat.

Explanation:

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
One strand of a DNA molecule has the following sequence: 3-AGTACAAACTATCCACCGTC-5. In order for transcription to occur in that s
guajiro [1.7K]

Answer: Promoter

Explanation:

Transcription is the first step in gene expression which consists of copying the DNA sequence of a gene to produce a RNA molecule. There are enzymes called <u>RNA polymerases which perform this process of transcription</u>. These enzymes bind nucleotides (the monomers which are part of the nucleic acids) to create a RNA strand using a DNA strand as a mold.

A promoter is a region of DNA that controls the initiation of transcription of a given portion of DNA to RNA. Therefore they promote the transcription of a gene. <u>The promoter region is composed of a specific sequence of DNA located just where the starting point of the DNA transcription is</u> and contains the information needed to activate or deactivate the gene it regulates. <u>The promoter has a binding site for the RNA polymerase enzyme </u>in charge of mRNA synthesis and when it recognizes this site, transcription begins.

6 0
3 years ago
The process of obtaining energy from glucose through chemical reactions.
densk [106]

Answer:

O, Assimilation

Explanation:

Assimilation is when cells take in things to use them as an energy source. So naturally assimilation is the answer.

Hope this helps!

8 0
2 years ago
how do you think the endocrine system and the nervous system work together to control communication in the body?
Lelu [443]

Explanation:

Ans. They use the help of the brain and nerves

3 0
2 years ago
Which is most associated with the building and repair of cells, organelles, and tissues?
KIM [24]

Answer:

Hi... Your answer is D...

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why do antibodies allow scientists to target and identify specific disease agents?
    11·1 answer
  • _______ are the most common type of joint found in the body. A. Fibrous B. Amphiarthroses C. Synarthroses D. Diarthroses
    10·2 answers
  • Plants produce all of the molecules they need for survival from inorganic compounds. Some elements, like nitrogen, come from the
    5·2 answers
  • The image is an aerial photograph. What is the geological feature shown? A) a large fault on Earth’s crust B) the dry bed of an
    12·1 answer
  • Plzzz helpp ASAP <br> WILL MARK BRAINLIEST
    9·2 answers
  • Who mandates that employers of emergency responders must take certain measures to protect employees who are likely to be exposed
    14·1 answer
  • Consider a gene that exists in two allelic forms in a simple Mendelian dominant/recessive pair. In a large population of randoml
    12·1 answer
  • Why do you think that the first thing you learn about in a Biology course is Chemistry? How does learning chemistry apply to Bio
    12·1 answer
  • Match the following with their proper definitions.
    5·1 answer
  • Bro you’re literally a furry
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!