1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
quester [9]
3 years ago
5

Ocean waves are hitting a beach with a frequency of 0.100 Hz. Their

Biology
1 answer:
Virty [35]3 years ago
3 0

Answer:

7 MPH or 11.27 KPH

Explanation:

Pls Mark Brainliest

You might be interested in
In one publication, the author implanted biomaterials subcutaneously in rats to test the biocompatibility of materials. At a few
Cerrena [4.2K]

Answer:

That the material can be mixed with the original tissue

Explanation:

The biomaterial has the idea to be mixed with the original tissue, due is going to grow (if it is based in cells) or is going to attach to the biological tissue, so the H&E method can be confused. The hematoxylin is going to stain the nuclei of the cells meanwhile the eosin is going to stain the extracellular matrix and cytoplasm, so, if the biomaterial is mixed in the original tissue, can be confused the exactly boundary among the biomaterial and the biological tissue.

Hope this info is useful.

5 0
3 years ago
Part A - Access and view the Louisiana Wetlands Loss: Coastal Erosion animation produced by New Orleans Times Picayune. Describe
Vikki [24]
Hi has been the jdmdmdmd
7 0
3 years ago
explain what determines the sex chromosome in males and females. explain what determines the sex of a baby ​
Law Incorporation [45]

Answer:

The sex chromosomes are referred to as X and Y, and their combination determines a person's sex. Typically, human females have two X chromosomes while males possess an XY pairing. This XY sex-determination system is found in most mammals as well as some reptiles and plants.

Men determine the sex of a baby depending on whether their sperm is carrying an X or Y chromosome. An X chromosome combines with the mother's X chromosome to make a baby girl (XX) and a Y chromosome will combine with the mother's to make a boy.

Explanation:

3 0
3 years ago
The mental process of actively and skillfully conceptualizing, applying, analyzing, synthesizing, and evaluating information to
nalin [4]
Critical thinking is the term defined as the mental process of actively and skillfully conceptualizing, applying, analyzing, synthesizing, and evaluating information to reach an answer or <span>conclusion.</span>
7 0
3 years ago
A bird is flying over a field. What will most likely happen if a toxin causes the
myrzilka [38]

Answer:

B. The bird will stop flying because it will quickly use up its remaining

energy.

Explanation:

This is because the mitochondria is known as the power house of cells. Oxidative phosphorylation takes place in this organelle and it involves the conversion of ADP to ATP through the hydrogen ions(protons).

When the hydrogen ion channel is blocked, energy production in cells stop.

This is why the bird will stop flying as it would have used up its remaining energy and won’t have a new one to use to continue flying.

3 0
3 years ago
Other questions:
  • 5. Why does photosynthesis require water? (1 point)
    10·1 answer
  • Water that has a very low pH can be collected from hot springs in the area of Glenwood Springs, Colorado. A low pH indicates whi
    11·1 answer
  • Describe the roles of bacteria in the nitrogen cycle
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A mutation in Complex I decreases the efficiency of the electron transport chain. However, not all components of the electron tr
    7·2 answers
  • SAQ-1:How do you take care of your own clothes
    11·2 answers
  • Which of these actions has contributed to the increase of greenhouse gases in the atmosphere?
    6·1 answer
  • Identify the tissues and write their main functions<br><br>9 to 11 carries three marks each​
    6·2 answers
  • Its a grade
    14·1 answer
  • Assertion (A): A proton gradient cannot be established in the mitochondria.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!