The Hawaiian state bird, the Nene, has an uncertain evolutionary history. It is thought that it has evolved from some other type of goose that was blown to the islands during a typhoon. Genomics would be most appropriate for addressing which research question regarding the Nene?
1 answer:
Answer:
It will address the research question of what type of goose (species) does the Nene evolved from.
Explanation:
Genomics uses the whole set of an organisms DNA to study and understand its' function, structure, and evolution. Scientists will use the Nene's genome set to study its evolution,basically telling a story where it comes from.
You might be interested in
Answer:
GGCCATAGGTCCCTTTAGCG
Explanation:
I got a 100%
Answer:
unidentified organism: Algae
Kingdom: Protista
Explanation:
Protista is any of the eukaryotic (membrane-bound nucleus) unicellular organisms including protozoans, slime molds and some ALGAE.
ALGAE is a AQUATIC, PHOTOSYNTHETIC organism. It can either be EUKARYOTIC or prokaryotic. a good example is seaweed.
The correct answer is nucleus
Answer:
Epithelial cells
Explanation:
Epithelial cells are cells that secret mucus to prevent friction between organs. Like between the Heart and Lung.
The flu is a viral disease.Cholera is the only bacterial disease in this list.
