1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
3 years ago
11

Only 2 and 3 thank you

Biology
1 answer:
Georgia [21]3 years ago
8 0
2 would be A because fertilization is where the sperm cell and egg unite. 3 would be C because in the picture you can see how the division is occuring.
You might be interested in
Please I NEED help!!!
Aleks [24]

Answer:

It can cause land subsidence

Explanation:

8 0
3 years ago
Explain two different perspectives of different marine industries on the carbon cycle.
allochka39001 [22]

Answer:

The marine industries affected the marine life and ocean water in many ways. When carbon dioxide dissolves in seawater, the water becomes more acidic and the ocean's pH drops. In the past two hundred years alone, ocean water has become 30 percent more acidic and faster than any known change in ocean chemistry in the last million years.

Hope it helps!

8 0
2 years ago
Which planet has 27 known moons? A. Uranus B. Neptune C. Saturn D. Jupiter
ivolga24 [154]
Uranus has 27 known moons.
7 0
2 years ago
Read 2 more answers
Please tell me answers I am given you brainliest ​
qwelly [4]

Answer:

Q2->They all form acids when combined with hydrogen. They are all fairly toxic. They readily combine with metals to form salts.

Q3->Because their outermost orbit is complete.  In Mendeleev's original periodic table there was no place reserved for noble gas.  They were discovered in end of 19th century.  So Mendeleev created zero group without disturbing original periodic table.

Explanation:

6 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The largest copper mine in the United States is located in Arizona. Why is copper considered to be a non-renewable resource?
    10·2 answers
  • What is a test cross
    9·1 answer
  • If an abnormal rearrangement or alignment of the bones results from a fracture, it is called a __________ fracture.
    9·2 answers
  • A population of birds has three beak variations, a large beak (suitable for eating seeds), long beaks (suitable for catching sma
    7·1 answer
  • which cause of aggressive dog behavior would most often be the easiest to remedy? A. Inadequate socialization B. Incompetent tra
    13·2 answers
  • What is the difference between evolution and coevolution? a) Evolution of one species only occurs in response to natural selecti
    8·1 answer
  • Please help, Using the rules of electricity, explain why peoples' hair stands up when a balloon is rubbed on their head.
    14·2 answers
  • Sperm cells must swim to the egg. What type of organelle must they contain? Why?
    7·2 answers
  • In the body, why do muscle cells and skin cells look and behave differently? Their genes are being expressed differently. The sa
    11·1 answer
  • When antibodies completely cover the surface of a virus so it can no longer infect a cell, it is said to be ______.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!