1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
3 years ago
6

Is there such thing as heterozygous recessive?

Biology
1 answer:
Anettt [7]3 years ago
8 0
Yes, heterozygous recessive is a thing it is a particular gene that has identical alleles its has the same letters for a dominant trait it's (XX) and for a recessive is lowercase (xx) just remember the alphabet the D is first then the R so D is capital and R is lower case  
You might be interested in
1) If you place the corner of a paper towel into a droplet of water, the water moves into the
nignag [31]

Answer:

D: Both cohesion and adhesion.

Have a great day! :)

7 0
3 years ago
Read 2 more answers
In this lab, biology students were directed to use indicators as chemical detection tools, to analyze a variety of foods for the
oee [108]

Answer:

Benedict's test which is meant to detect non-reducing sugar like sucrose from reducing sugars like glucose, fructose or galactose can be used to identify sucrose.

Explanation:

Glucose, fructose and galactose are reducing sugars so they can easily be identified against non-reducing like sucrose. A reducing sugar is a kind of sugar which has a free aldehyde or ketone group. Free aldehyde and ketone groups act as a reducing agent and they are capable of reducing other substances. In this situation, the reducing sugar reduces other substances and themselves get oxidized. In contrast to this, a non-reducing sugar can not act as a reducing agent because it has lack of a free aldehyde or ketone group.

Benedict's test is a test which is used to identify a non reducing sugar from reducing sugars. In this test, a reducing sugar (Glucose, fructose or galactose) is heated with Benedict's solution which leads to the change of color of solution to orange-red/ brick red. But no such color change will be detected if sucrose is heated with Benedict's solution.

6 0
4 years ago
Pathology examination of tissue removed during a pancreas biopsy. report code _____.
Bezzdna [24]
The answer is report code 88307. In addition, pathology is a medical field that is apprehensive with the analysis of disease established on the gross, minuscular, biochemical, immunologic and molecular investigation of organs, tissues and whole bodies as in a general examination or an autopsy. 
3 0
3 years ago
The nurse assess which patient for nosocomial pnuemonia
stepan [7]
<span>The patient receiving mechanical ventilation.</span>
5 0
3 years ago
Which of the following could be a method used to estimate the age of an ancient rock? To find out its mineral composition To fin
romanna [79]
I believe it would be to calculate the amount of C-14 atoms left. scientists began to find out how long an object has been decaying, this has to do with half lifes etc. and how long a specific mineral/elements half life is. they use this to calculate how old it is (not an exact age but it's very accurate.)
3 0
3 years ago
Read 2 more answers
Other questions:
  • Assume that the average protein in
    7·1 answer
  • Diatoms are one of the most common types of phytoplankton in marine habitats.
    10·1 answer
  • Living organisms break down polysaccharides into simple sugars
    10·1 answer
  • When a yoruba sculptor created a human form, he or she made this body part disproportionately large:?
    11·1 answer
  • Which of the following is an example of asexual reproduction?
    6·1 answer
  • The processing of combining what you know with what you have learn to draw logical conclusion is called
    14·1 answer
  • How much exercise is recommended for children?
    8·2 answers
  • Someone please help me I will mark you BRAINLIST I need help with all 6 questions please
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which Image shows the difference between the speed of molecules in hot and cold water
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!