1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maks197457 [2]
3 years ago
11

The somewhat-predictable series of changes to ecosystems over time is called

Biology
1 answer:
olchik [2.2K]3 years ago
7 0
I believed it is Ecological Succession
You might be interested in
A frame which is used for ecological sampling
Alinara [238K]

Answer:

A quadrat is a frame (usually a square or a circle) of known area used to isolate a subset of the population. This subset will comprise one sample. Quadrats come in various sizes (and shapes) with the size selected determined by features of the organisms in the population to be sampled.

Explanation:

hope this helps

5 0
3 years ago
Are microorganisms best suited for dry, warm environments?
gregori [183]

Answer:

The most significant effect of the microbes on earth is their ability to recycle the primary elements that make up all living systems, especially carbon, oxygen, and nitrogen (N). Primary production involves photosynthetic organisms which take up CO2 from the atmosphere and convert it to organic (cellular) material.

5 0
2 years ago
The nucleus serves as
Xelga [282]
The brain of the cell most important
4 0
3 years ago
Read 2 more answers
What is the copulation​
pishuonlain [190]

Answer:

copulation means that which ingage in sexual intercourse which penis is inserted into vagina and to transfer male reproductive cells from one induvidual to another.

5 0
3 years ago
These are statements or phrases that surround a word that help to explain its meaning.
sammy [17]
Statements that surround a word that help to explain its meaning are called CONTEXT OR CONTEXT CLUES.
The meaning of a word can be derived from the context clues that surrounded it. A word may have different meanings depending on the type of context in which it is found.<span />
4 0
4 years ago
Other questions:
  • A male and female bison that are both heterozygous for normal skin pigmentation (aa) produce an albino offspring (aa). which of
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Gene therapy is a form of __________
    10·2 answers
  • What is the main function of a phospholipids in a cell
    12·2 answers
  • What allows water to dissolve compounds
    5·2 answers
  • |
    12·1 answer
  • 7. Some cancers are caused by mutations that stop certain proteins from working. The inactivation of what kind of protein could
    10·1 answer
  • Some species, such as humans and pandas, take a very long time to reproduce. Why might this be adventageous to the species as a
    10·1 answer
  • steel is a mixture of iron and carbon.it cant be separated into iron and carbon by melting it.what is steel?
    10·1 answer
  • Which scenario MOST LIKELY represents genetic drift and why?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!