1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
4 years ago
11

Where does rna polymerase begin transcribing a gene into mrna?

Biology
1 answer:
Alina [70]4 years ago
8 0
<span>Transcription begins after a certain nucleotide sequence called the "promoter". The sequence consists of the following: 
1) The AUG start codon is identified 
2) Transfer RNA translates the message to the RNA polymerase 
3) Ribosomes direct it to the correct segment of the DNA molecule

REMEMBER: 
- Nucleotide synthesis = promoter 
- Synthesis initiates at one end of the chromosome


</span>
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
If a decision was made to convert forest to agriculture, which would be an
kifflom [539]

Answer:

B

Explanation:

Because the roots of the tree were what where controling the erosion

Hope this helps :))

6 0
3 years ago
Read 2 more answers
Which level of organization is seen in both Arachnoidiscus ehrenbergi and the human stomach? cell tissue organ organ system
guajiro [1.7K]

Answer;

Cell  

Explanation;

-The biological levels of organization of living things arranged from the simplest to most complex are: organelle, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystem, and biosphere.

-Cell is the basic unit and building block of life. It is bound by a cell membrane, and possesses a nucleus which acts as its brain. Arachnoidiscus ehrenbergi  is an example of diatoms which are unicellular, therefore it is a cell.

4 0
3 years ago
Read 2 more answers
Which of the following dating techniques provides scientists with strong evidence that helps determine the age of a fossil? both
myrzilka [38]
It is relative dating because no scientist can tell the actually time that the layers of rocks where formed or when the fossil began to degrade 
5 0
3 years ago
Read 2 more answers
Which of the following is NOT a function of blood cells?
Liono4ka [1.6K]
The answer is (C), because, red blood cells or wbc regulate body temperature (Idr), wbc fight infections, and rbc transport nutrients
4 0
3 years ago
Other questions:
  • How have humans affected their environment over time?
    5·2 answers
  • If a couple has a one-in-four risk of having a child with an inheritable disease,<br>then​
    14·1 answer
  • What is released when bonds are broken to create heat?
    10·1 answer
  • 2. Gas exchange occurs in the bark through light and dark disruptions called:
    12·2 answers
  • How does a frog use its legs while swimming
    5·1 answer
  • The proportions of a population that are at different age levels make up the population’s a. fertility rate. c. age structure. b
    9·1 answer
  • Will mark brainliest and give 15 points if you give explanation to the answer you give
    8·1 answer
  • As the mitochondria metabolize the glucose, they produce carbon dioxide waste. Would the
    11·1 answer
  • In the investigation where we combined the bath bomb with water, we saw bubbles forming but we did not see an increase in the ov
    13·2 answers
  • Describe the way the heart is pumping and creating cardiac output,What are factors that can change cardiac output? Explain the s
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!