1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
7

What do hydrometers test ?

Biology
2 answers:
djverab [1.8K]3 years ago
4 0
A hydrometer<span> or areometer is an instrument that measures the specific gravity (relative density) of liquids—the ratio of the density of the liquid to the density of water. A </span>hydrometer<span> is usually made of glass, and consists of a cylindrical stem and a bulb weighted with mercury or lead shot to make it float upright.</span>
crimeas [40]3 years ago
3 0
A hydrometer<span> or areometer is an instrument that measures the specific gravity of liquids, the ratio of the density of the liquid to the density of water.</span><span>
Hope this helps!
Stay smart,
~{Dunsforhands}</span>
You might be interested in
When the heart is working inside the body, the job of the atria is to
photoshop1234 [79]

Answer:

D. Fill the ventricles.

Explanation:

The medical definition is "an anatomical cavity or passage especially : a chamber of the heart that receives blood from the veins and forces it into a ventricle or ventricles."

8 0
3 years ago
Read 2 more answers
The main difference between stream pools and ponds is that stream pools
Elan Coil [88]
Contain differnt aquatic creatures
3 0
4 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Shoe companies often pair their logos with successful athletes in order to get you excited about buying their shoes. Prior to th
Kisachek [45]

Answer: neutral response

Explanation:

neutral response because before no one is really interested in buying the shoes so they would have a neutral response but when it is paired with athletes you now would want to buy it

Hope this helps :)

Please mark brainliest !!!

7 0
2 years ago
Hola como estan soy nueva
alukav5142 [94]

Answer:

Buena gracias

Explanation:

4 0
3 years ago
Other questions:
  • The tube that connects the bladder and the outside is called the
    11·1 answer
  • How does solubility work?
    12·1 answer
  • In general, locomotion on land will require more energy than locomotion in water. By integrating what you learned about animal f
    15·1 answer
  • the maintainnce of healthy bones depend on the balance of osteoblast and osteoclast activity, predict what would happen if osteo
    10·2 answers
  • Which of the following units is used in the household measurement system?
    11·1 answer
  • We have 4 oceans<br> How did your predictions match the tracking data for each bottle?
    14·1 answer
  • What is a method of artificial selection?
    11·1 answer
  • What would happen to a population if all females reproduce through parthenogenesis alone?
    12·1 answer
  • The code for a DNA strand is CGTA. What is the complementary strand?
    6·2 answers
  • How long does better than bouillon last after opening
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!